MEGAResFrom MEG, the Microbial Ecology Group

NDH

The ndh gene encodes a NADH dehydrogenase that, when specific mutations are present, results in coresistance of ethionamide and isoniazid in Mycobacterium tuberculosis.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC90621/

Other Groups in Isoniazid-resistant mutant

Sequences

Download Sequences

>>MEG_4130|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|NDH|RequiresSNPConfirmation
ATGAGTCCCCAGCAAGAACCCACAGCGCAACCACCTCGTAGGCATCGAGTTGTGATCATCGGATCTGGGTTCGGCGGGCT
AAACGCGGCAAAGAAGCTCAAGCGGGCCGACGTTGACATCAAGCTGATCGCGCGCACCACCCATCACCTGTTCCAGCCGC
TGCTGTACCAAGTGGCCACCGGGATTATCTCCGAGGGAGAAATCGCTCCGCCGACCCGGGTCGTGCTGCGTAAGCAGCGC
AATGTCCAGGTACTGTTGGGCAACGTCACCCACATCGACCTGGCCGGGCAGTGCGTCGTCTCGGAATTGCTCGGTCACAC
CTACCAAACCCCCTACGACAGCCTGATCGTCGCCGCGGGTGCTGGCCAGTCTTATTTCGGCAACGACCATTTCGCCGAAT
TCGCACCCGGCATGAAGTCCATCGACGACGCGTTGGAGTTGCGTGGCCGCATATTGAGCGCTTTCGAGCAAGCCGAACGG
TCCAGCGATCCGGAACGGCGGGCCAAGCTACTGACATTCACCGTTGTCGGGGCTGGCCCCACCGGTGTTGAAATGGCCGG
ACAGATCGCCGAGCTGGCCGAGCACACGTTGAAGGGCGCATTCCGGCACATCGACTCGACCAAGGCGCGGGTGATTCTGC
TTGACGCCGCCCCGGCGGTGCTGCCACCGATGGGCGCAAAGCTCGGTCAGCGGGCGGCTGCCCGGTTGCAGAAGCTGGGC
GTGGAAATCCAGCTGGGTGCGATGGTCACCGACGTCGACCGCAACGGCATCACCGTCAAGGACTCCGACGGCACCGTCCG
GCGCATCGAGTCGGCCTGCAAGGTCTGGTCGGCCGGGGTTTCGGCCAGTCGGTTGGGCAGGGACCTTGCCGAGCAATCAC
GGGTTGAGCTCGACCGGGCCGGCCGGGTCCAAGTGCTGCCCGACCTGTCCATTCCCGGGTACCCGAACGTGTTCGTGGTG
GGCGATATGGCCGCTGTGGAGGGTGTGCCGGGTGTGGCGCAGGGCGCCATCCAGGGGGCGAAATACGTCGCCAGCACGAT
CAAGGCCGAACTGGCCGGCGCCAACCCGGCGGAGCGTGAGCCATTCCAGTACTTCGACAAGGGATCGATGGCCACGGTTT
CGAGGTTTTCGGCGGTGGCCAAGATCGGTCCCGTTGAGTTCAGCGGCTTTATCGCCTGGCTGATTTGGCTGGTGCTGCAC
CTGGCGTACCTGATCGGGTTCAAGACCAAGATCACCACTCTGCTGTCGTGGACGGTGACTTTCCTCAGTACTCGCCGCGG
CCAGCTGACCATCACCGACCAGCAGGCATTTGCGCGAACGCGGCTCGAACAGCTGGCCGAGCTGGCCGCCGAGGCGCAGG
GCTCAGCGGCAAGCGCTAAGGTGGCCAGCTAG

>>MEG_4131|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|NDH|RequiresSNPConfirmation
ATGAGTCCCCAGCAAGAACCCACAGCGCAACCACCTCGTAGGCATCGAGTTGTGATCATCGGATCTGGGTTCGGCGGGCT
AAACGCGGCAAAGAAGCTCAAGCGGGCCGACGTTGACATCAAGCTGATCGCGCGCACCACCCATCACCTGTTCCAGCCGC
TGCTGTACCAAGTGGCCACCGGGATTATCTCCGAGGGAGAAATCGCTCCGCCGACCCGGGTCGTGCTGCGTAAGCAGCGC
AATGTCCAGGTACTGTTGGGCAACGTCACCCACATCGACCTGGCCGGGCAGTGCGTCGTCTCGGAATTGCTCGGTCACAC
CTACCAAACCCCCTACGACAGCCTGATCGTCGCCGCGGGTGCTGGCCAGTCTTATTTCGGCAACGACCATTTCGCCGAAT
TCGCACCCGGCATGAAGTCCATCGACGACGCGTTGGAGTTGCGTGGCCGCATATTGAGCGCTTTCGAGCAAGCCGAACGG
TCCAGCGATCCGGAACGGCGGGCCAAGCTACTGACATTCACCGTTGTCGGGGCTGGCCCCACCGGTGTTGAAATGGCCGG
ACAGATCGCCGAGCTGGCCGAGCACACGTTGAAGGGCGCATTCCGGCACATCGACTCGACCAAGGCGCGGGTGATTCTGC
TTGACGCCGCCCCGGCGGTGCTGCCACCGATGGGCGCAAAGCTCGGTCAGCGGGCGGCTGCCCGGTTGCAGAAGCTGGGC
GTGGAAATCCAGCTGGGTGCGATGGTCACCGACGTCGACCGCAACGGCATCACCGTCAAGGACTCCGACGGCACCGTCCG
GCGCATCGAGTCGGCCTGCAAGGTCTGGTCGGCCGGGGTTTCGGCCAGTCGGTTGGGCAGGGACCTTGCCGAGCAATCAC
GGGTTGAGCTCGACCGGGCCGGCCGGGTCCAAGTGCTGCCCGACCTGTCCATTCCCCGGTACCCGAACGTGTTCGTGGTG
GGCGATATGGCCGCTGTGGAGGGTGTGCCGGGTGTGGCGCAGGGCGCCATCCAGGGGGCGAAATACGTCGCCAGCACGAT
CAAGGCCGAACTGGCCGGCGCCAACCCGGCGGAGCGTGAGCCATTCCAGTACTTCGACAAGGGATCGATGGCCACGGTTT
CGAGGTTTTCGGCGGTGGCCAAGATCGGTCCCGTTGAGTTCAGCGGCTTTATCGCCTGGCTGATTTGGCTGGTGCTGCAC
CTGGCGTACCTGATCGGGTTCAAGACCAAGATCACCACTCTGCTGTCGTGGACGGTGACTTTCCTCAGTACTCGCCGCGG
CCAGCTGACCATCACCGACCAGCAGGCATTTGCGCGAACGCGGCTCGAACAGCTGGCCGAGCTGGCCGCCGAGGCGCAGG
GCTCAGCGGCAAGCGCTAAGGTGGCCAGCTAG

>>MEG_4132|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|NDH|RequiresSNPConfirmation
ATGAGCCATCCCGGAGCTACGGCGTCGGATCGGCATAAAGTCGTCATCATCGGTTCGGGTTTCGGTGGTCTCACCGCTGC
CAAGACCCTCAAGCGCGCTGACGTCGACGTCAAGCTAATCGCCCGTACCACGCACCACCTCTTCCAGCCGCTGCTCTACC
AGGTGGCGACCGGCATCATCTCCGAGGGCGAGATCGCCCCGGCCACTCGAGTGATCCTCCGCAAGCAGAAGAACGCCCAG
GTCCTTCTCTGCGATGTGACGCACATCGATCTGGAGAACAAGACCGTGGATTCGGTGCTGCTCGGTCACACCTACTCGAC
GCCCTACGACAGCCTCATCATCGCCGCGGGCGCGGGTCAGTCCTACTTCGGCAACGACCACTTCGCCGAGTTCGCACCCG
GCATGAAGTCGATCGACGATGCGCTGGAGCTGCGCGGTCGCATCCTCGGCGCGTTCGAACAGGCCGAGCGCTCCAGCGAC
CCGGTGCGCCGCGCGAAGTTGCTGACGTTCACCGTCGTCGGCGCGGGCCCGACCGGCGTCGAGATGGCCGGACAGATCGC
CGAATTGGCCGACCAGACTTTGCGGGGCAGCTTCCGCCACATCGATCCCACCGAGGCCCGGGTGATCCTGCTCGACGCCG
CACCGGCCGTGCTACCGCCCATGGGCGAGAAGCTCGGCAAGAAGGCGCGGGCCCGTCTGGAGAAGATGGGCGTCGAGGTC
CAGCTGGGTGCGATGGTCACCGACGTCGACCGCAACGGCATCACCGTCAAGGATTCCGACGGGACCATCCGTCGCATCGA
GTCGGCGTGCAAGGTGTGGTCGGCCGGTGTGTCGGCCAGCCCTCTCGGCAAGGATCTCGCCGAGCAGTCGGGTGTCGAAC
TCGACCGCGCGGGCCGGGTCAAGGTACAGCCCGACCTGACGCTGCCCGGTCACCCGAACGTGTTCGTCGTGGGCGACATG
GCGGCCGTCGAGGGCGTGCCCGGTGTGGCGCAGGGCGCCATCCAGGGTGGCCGCTACGCCGCGAAGATCATCAAGCGTGA
GGTCAGTGGCACCAGCCCGAAGATCCGCACGCCGTTCGAGTACTTCGACAAGGGCTCGATGGCGACGGTGTCGCGGTTCT
CCGCGGTGGCCAAGGTGGGTCCCGTCGAGTTCGCGGGCTTCTTCGCCTGGTTGTGCTGGCTCGTGCTGCACCTGGTGTAC
CTGGTCGGGTTCAAGACGAAGATCGTCACACTGCTGTCGTGGGGCGTGACGTTCCTGAGCACCAAGCGTGGTCAGCTCAC
CATCACCGAGCAGCAGGCCTATGCGCGAACCCGCATCGAGGAGCTCGAGGAGATCGCGGCGGCGGTGCAGGACACCGAGA
AAGCCGCGTCCTAG