MEGAResFrom MEG, the Microbial Ecology Group

KATG

The KATG group of genes confer resistance to Mycobacterium tuberculosis-specific Drug through the mechanism, Isoniazid-resistant mutation.

References

    Other Groups in Isoniazid-resistant mutant

    Sequences

    Download Sequences

    >>MEG_3446|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|KATG|RequiresSNPConfirmation
    GTGCCCGAGCAACACCCACCCATTACAGAAACCACCACCGGAGCCGCTAGCAACGGCTGTCCCGTCGTGGGTCATATGAA
    ATACCCCGTCGAGGGCGGCGGAAACCAGGACTGGTGGCCCAACCGGCTCAATCTGAAGGTACTGCACCAAAACCCGGCCG
    TCGCTGACCCGATGGGTGCGGCGTTCGACTATGCCGCGGAGGTCGCGACCATCGACGTTGACGCCCTGACGCGGGACATC
    GAGGAAGTGATGACCACCTCGCAGCCGTGGTGGCCCGCCGACTACGGCCACTACGGGCCGCTGTTTATCCGGATGGCGTG
    GCACGCTGCCGGCACCTACCGCATCCACGACGGCCGCGGCGGCGCCGGGGGCGGCATGCAGCGGTTCGCGCCGCTTAACA
    GCTGGCCCGACAACGCCAGCTTGGACAAGGCGCGCCGGCTGCTGTGGCCGGTCAAGAAGAAGTACGGCAAGAAGCTCTCA
    TGGGCGGACCTGATTGTTTTCGCCGGCAACTGCGCGCTGGAATCGATGGGCTTCAAGACGTTCGGGTTCGGCTTCGGCCG
    GGTCGACCAGTGGGAGCCCGATGAGGTCTATTGGGGCAAGGAAGCCACCTGGCTCGGCGATGAGCGTTACAGCGGTAAGC
    GGGATCTGGAGAACCCGCTGGCCGCGGTGCAGATGGGGCTGATCTACGTGAACCCGGAGGGGCCGAACGGCAACCCGGAC
    CCCATGGCCGCGGCGGTCGACATTCGCGAGACGTTTCGGCGCATGGCCATGAACGACGTCGAAACAGCGGCGCTGATCGT
    CGGCGGTCACACTTTCGGTAAGACCCATGGCGCCGGCCCGGCCGATCTGGTCGGCCCCGAACCCGAGGCTGCTCCGCTGG
    AGCAGATGGGCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATCACCAGCGGCATCGAGGTCGTA
    TGGACGAACACCCCGACGAAATGGGACAACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCTGACGAAGAGCCC
    TGCTGGCGCTTGGCAATACACCGCCAAGGACGGCGCCGGTGCCGGCACCATCCCGGACCCGTTCGGCGGGCCAGGGCGCT
    CCCCGACGATGCTGGCCACTGACCTCTCGCTGCGGGTGGATCCGATCTATGAGCGGATCACGCGTCGCTGGCTGGAACAC
    CCCGAGGAATTGGCCGACGAGTTCGCCAAGGCCTGGTACAAGCTGATCCACCGAGACATGGGTCCCGTTGCGAGATACCT
    TGGGCCGCTGGTCCCCAAGCAGACCCTGCTGTGGCAGGATCCGGTCCCTGCGGTCAGCCACGACCTCGTCGGCGAAGCCG
    AGATTGCCAGCCTTAAGAGCCAGATCCGGGCATCGGGATTGACTGTCTCACAGCTAGTTTCGACCGCATGGGCGGCGGCG
    TCGTCGTTCCGTGGTAGCGACAAGCGCGGCGGCGCCAACGGTGGTCGCATCCGCCTGCAGCCACAAGTCGGGTGGGAGGT
    CAACGACCCCGACGGGGATCTGCGCAAGGTCATTCGCACCCTGGAAGAGATCCAGGAGTCATTCAACTCCGCGGCGCCGG
    GGAACATCAAAGTGTCCTTCGCCGACCTCGTCGTGCTCGGTGGCTGTGCCGCCATAGAGAAAGCAGCAAAGGCGGCTGGC
    CACAACATCACGGTGCCCTTCACCCCGGGCCGCACGGATGCGTCGCAGGAACAAACCGACGTGGAATCCTTTGCCGTGCT
    GGAGCCCAAGGCAGATGGCTTCCGAAACTACCTCGGAAAGGGCAACCCGTTGCCGGCCGAGTACATGCTGCTCGACAAGG
    CGAACCTGCTTACGCTCAGTGCCCCTGAGATGACGGTGCTGGTAGGTGGCCTGCGCGTCCTCGGCGCAAACTACAAGCGC
    TTACCGCTGGGCGTGTTCACCGAGGCCTCCGAGTCACTGACCAACGACTTCTTCGTGAACCTGCTCGACATGGGTATCAC
    CTGGGAGCCCTCGCCAGCAGATGACGGGACCTACCAGGGCAAGGATGGCAGTGGCAAGGTGAAGTGGACCGGCAGCCGCG
    TGGACCTGGTCTTCGGGTCCAACTCGGAGTTGCGGGCGCTTGTCGAGGTCTATGGCGCCGATGACGCGCAGCCGAAGTTC
    GTGCAGGACTTCGTCGCTGCCTGGGACAAGGTGATGAACCTCGACAGGTTCGACGTGCGCTGA