MEGAResFrom MEG, the Microbial Ecology Group

KASA

The kasA gene encodes a beta-ketoacyl synthase that participates in fatty acid elongation in Mycobacterium tuberculosis. Isoniazid targets fatty acid elongation mechanisms that are essential to the bacteria, therefore specific mutations in kasA can result in resistance to isoniazid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12464486

Other Groups in Isoniazid-resistant mutant

Sequences

Download Sequences

>>MEG_3445|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|KASA|RequiresSNPConfirmation
GTGAGTCAGCCTTCCACCGCTAATGGCGGTTTCCCCAGCGTTGTGGTGACCGCCGTCACAGCGACGACGTCGATCTCGCC
GGACATCGAGAGCACGTGGAAGGGTCTGTTGGCCGGCGAGAGCGGCATCCACGCACTCGAAGACGAGTTCGTCACCAAGT
GGGATCTAGCGGTCAAGATCGGCGGTCACCTCAAGGATCCGGTCGACAGCCACATGGGCCGACTCGACATGCGACGCATG
TCGTACGTCCAGCGGATGGGCAAGTTGCTGGGCGGACAGCTATGGGAGTCCGCCGGCAGCCCGGAGGTCGATCCAGACCG
GTTCGCCGTTGTTGTCGGCACCGGTCTAGGTGGAGCCGAGAGGATTGTCGAGAGCTACGACCTGATGAATGCGGGCGGCC
CCCGGAAGGTGTCCCCGCTGGCCGTTCAGATGATCATGCCCAACGGTGCCGCGGCGGTGATCGGTCTGCAGCTTGGGGCC
CGCGCCGGGGTGATGACCCCGGTGTCGGCCTGTTCGTCGGGCTCGGAAGCGATCGCCCACGCGTGGCGTCAGATCGTGAT
GGGCGACGCCGACGTCGCCGTCTGCGGCGGTGTCGAAGGACCCATCGAGGCGCTGCCCATCGCGGCGTTCTCCATGATGC
GGGCCATGTCGACCCGCAACGACGAGCCTGAGCGGGCCTCCCGGCCGTTCGACAAGGACCGCGACGGCTTTGTGTTCGGC
GAGGCCGGTGCGCTGATGCTCATCGAGACGGAGGAGCACGCCAAAGCCCGTGGCGCCAAGCCGTTGGCCCGATTGCTGGG
TGCCGGTATCACCTCGGACGCCTTTCATATGGTGGCGCCCGCGGCCGATGGTGTTCGTGCCGGTAGGGCGATGACTCGCT
CGCTGGAGCTGGCCGGGTTGTCGCCGGCGGACATCGACCACGTCAACGCGCACGGCACGGCGACGCCTATCGGCGACGCC
GCGGAGGCCAACGCCATCCGCGTCGCCGGTTGTGATCAGGCCGCGGTGTACGCGCCGAAGTCTGCGCTGGGCCACTCGAT
CGGCGCGGTCGGTGCGCTCGAGTCGGTGCTCACGGTGCTGACGCTGCGCGACGGCGTCATCCCGCCGACCCTGAACTACG
AGACACCCGATCCCGAGATCGACCTTGACGTCGTCGCCGGCGAACCGCGCTATGGCGATTACCGCTACGCAGTCAACAAC
TCGTTCGGGTTCGGCGGCCACAATGTGGCGCTTGCCTTCGGGCGTTACTGA