MEGAResFrom MEG, the Microbial Ecology Group

INHA

The inhA gene has been implicated in the fatty acid elongation system of Mycobacterium tuberculosis. Isoniazid targets inhA, therefore mutations in this gene can result in resistance to isoniazid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/10708367

Other Groups in Isoniazid-resistant mutant

Sequences

Download Sequences

>>MEG_3429|Drugs|Mycobacterium_tuberculosis-specific_Drug|Isoniazid-resistant_mutant|INHA|RequiresSNPConfirmation
ATGACAGGACTGCTGGACGGCAAACGGATTCTGGTTAGCGGAATCATCACCGACTCGTCGATCGCGTTTCACATCGCACG
GGTAGCCCAGGAGCAGGGCGCCCAGCTGGTGCTCACCGGGTTCGACCGGCTGCGGCTGATTCAGCGCATCACCGACCGGC
TGCCGGCAAAGGCCCCGCTGCTCGAACTCGACGTGCAAAACGAGGAGCACCTGGCCAGCTTGGCCGGCCGGGTGACCGAG
GCGATCGGGGCGGGCAACAAGCTCGACGGGGTGGTGCATTCGATTGGGTTCATGCCGCAGACCGGGATGGGCATCAACCC
GTTCTTCGACGCGCCCTACGCGGATGTGTCCAAGGGCATCCACATCTCGGCGTATTCGTATGCTTCGATGGCCAAGGCGC
TGCTGCCGATCATGAACCCCGGAGGTTCCATCGTCGGCATGGACTTCGACCCGAGCCGGGCGATGCCGGCCTACAACTGG
ATGACGGTCGCCAAGAGCGCGTTGGAGTCGGTCAACAGGTTCGTGGCGCGCGAGGCCGGCAAGTACGGTGTGCGTTCGAA
TCTCGTTGCCGCAGGCCCTATCCGGACGCTGGCGATGAGTGCGATCGTCGGCGGTGCGCTCGGCGAGGAGGCCGGCGCCC
AGATCCAGCTGCTCGAGGAGGGCTGGGATCAGCGCGCTCCGATCGGCTGGAACATGAAGGATGCGACGCCGGTCGCCAAG
ACGGTGTGCGCGCTGCTGTCTGACTGGCTGCCGGCGACCACGGGTGACATCATCTACGCCGACGGCGGCGCGCACACCCA
ATTGCTCTAG