MEGAResFrom MEG, the Microbial Ecology Group

ETHA

The ethA gene is an enzyme that participates in the activation of ethionamide, a Mycobacterium tuberculosis-specific drug. Mutations in ethA can result in resistance when this enzyme no longer functions as in the wild-type bacteria.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/11823459

Sequences

Download Sequences

>>MEG_2866|Drugs|Mycobacterium_tuberculosis-specific_Drug|Ethionamide-resistant_mutant|ETHA|RequiresSNPConfirmation
ATGACCGAGCACCTCGACGTTGTCATCGTGGGCGCTGGAATCTCCGGTGTCAGCGCGGCCTGGCACCTGCAGGACCGTTG
CCCGACCAAGAGCTACGCCATCCTGGAAAAGCGGGAATCCATGGGCGGCACCTGGGATTTGTTCCGTTATCCCGGAATTC
GCTCCGACTCCGACATGTACACGCTAGGTTTCCGATTCCGTCCCTGGACCGGACGGCAGGCGATCGCCGACGGCAAGCCC
ATCCTCGAGTACGTCAAGAGCACCGCGGCCATGTATGGAATCGACAGGCATATCCGGTTCCACCACAAGGTGATCAGTGC
CGATTGGTCGACCGCGGAAAACCGCTGGACCGTTCACATCCAAAGCCACGGCACGCTCAGCGCCCTCACCTGCGAATTCC
TCTTTCTGTGCAGCGGCTACTACAACTACGACGAGGGCTACTCGCCGAGATTCGCCGGCTCGGAGGATTTCGTCGGGCCG
ATCATCCATCCGCAGCACTGGCCCGAGGACCTCGACTACGACGCTAAGAACATCGTCGTGATCGGCAGTGGCGCAACGGC
GGTCACGCTCGTGCCGGCGCTGGCGGACTCGGGCGCCAAGCACGTCACGATGCTGCAGCGCTCACCCACCTACATCGTGT
CGCAGCCAGACCGGGACGGCATCGCCGAGAAGCTCAACCGCTGGCTGCCGGAGACCATGGCCTACACCGCGGTACGGTGG
AAGAACGTGCTGCGCCAGGCGGCCGTGTACAGCGCCTGCCAGAAGTGGCCACGGCGCATGCGGAAGATGTTCCTGAGCCT
GATCCAGCGCCAGCTACCCGAGGGGTACGACGTGCGAAAGCACTTCGGCCCGCACTACAACCCCTGGGACCAGCGATTGT
GCTTGGTGCCCAACGGCGACCTGTTCCGGGCCATTCGTCACGGGAAGGTCGAGGTGGTGACCGACACCATTGAACGGTTC
ACCGCGACCGGAATCCGGCTGAACTCAGGTCGCGAACTGCCGGCTGACATCATCATTACCGCAACGGGGTTGAACCTGCA
GCTTTTTGGTGGGGCGACGGCGACTATCGACGGACAACAAGTGGACATCACCACGACGATGGCCTACAAGGGCATGATGC
TTTCCGGCATCCCCAACATGGCCTACACGGTTGGCTACACCAATGCCTCCTGGACGCTGAAGGCCGACCTGGTGTCGGAG
TTTGTCTGTCGCTTGTTGAATTACATGGACGACAACGGTTTTGACACCGTGGTCGTCGAGCGACCGGGCTCAGATGTCGA
AGAGCGGCCCTTCATGGAGTTCACCCCAGGTTACGTGCTGCGCTCGCTGGACGAGCTGCCCAAGCAGGGTTCGCGTACAC
CGTGGCGCCTGAATCAGAACTACCTACGTGACATCCGGCTCATCCGGCGCGGCAAGATCGACGACGAGGGTCTGCGGTTC
GCCAAAAGGCCTGCCCCGGTGGGGGTTTAG