MEGAResFrom MEG, the Microbial Ecology Group

ETHA

The ethA gene is an enzyme that participates in the activation of ethionamide, a Mycobacterium tuberculosis-specific drug. Mutations in ethA can result in resistance when this enzyme no longer functions as in the wild-type bacteria.

References

Sequences

Download Sequences

>CARD|pvgb|AE000516|4318327-4319797|ARO:3003458|mycobacterium|Mycobacterium_tuberculosis-specific_Drug|Ethionamide-resistant_monooxygenase_EthA|ETHA|RequiresSNPConfirmation
CTAAACCCCCACCGGGGCAGGCCTTTTGGCGAACCGCAGACCCTCGTCGTCGATCTTGCCGCGCCGGATGAGCCGGATGT
CACGTAGGTAGTTCTGATTCAGGCGCCACGGTGTACGCGAACCCTGCTTGGGCAGCTCGTCCAGCGAGCGCAGCACGTAA
CCTGGGGTGAACTCCATGAAGGGCCGCTCTTCGACATCTGAGCCCGGTCGCTCGACGACCACGGTGTCAAAACCGTTGTC
GTCCATGTAATTCAACAAGCGACAGACAAACTCCGACACCAGGTCGGCCTTCAGCGTCCAGGAGGCATTGGTGTAGCCAA
CCGTGTAGGCCATGTTGGGGATGCCGGAAAGCATCATGCCCTTGTAGGCCATCGTCGTGGTGATGTCCACTTGTTGTCCG
TCGATAGTCGCCGTCGCCCCACCAAAAAGCTGCAGGTTCAACCCCGTTGCGGTAATGATGATGTCAGCCGGCAGTTCGCG
ACCTGAGTTCAGCCGGATTCCGGTCGCGGTGAACCGTTCAATGGTGTCGGTCACCACCTCGACCTTCCCGTGACGAATGG
CCCGGAACAGGTCGCCGTTGGGCACCAAGCACAATCGCTGGTCCCAGGGGTTGTAGTGCGGGCCGAAGTGCTTTCGCACG
TCGTACCCCTCGGGTAGCTGGCGCTGGATCAGGCTCAGGAACATCTTCCGCATGCGCCGTGGCCACTTCTGGCAGGCGCT
GTACACGGCCGCCTGGCGCAGCACGTTCTTCCACCGTACCGCGGTGTAGGCCATGGTCTCCGGCAGCCAGCGGTTGAGCT
TCTCGGCGATGCCGTCCCGGTCTGGCTGCGACACGATGTAGGTGGGTGAGCGCTGCAGCATCGTGACGTGCTTGGCGCCC
GAGTCCGCCAGCGCCGGCACGAGCGTGACCGCCGTTGCGCCACTGCCGATCACGACGATGTTCTTAGCGTCGTAGTCGAG
GTCCTCGGGCCAGTGCTGCGGATGGATGATCGGCCCGACGAAATCCTCCGAGCCGGCGAATCTCGGCGAGTAGCCCTCGT
CGTAGTTGTAGTAGCCGCTGCACAGAAAGAGGAATTCGCAGGTGAGGGCGCTGAGCGTGCCGTGGCTTTGGATGTGAACG
GTCCAGCGGTTTTCCGCGGTCGACCAATCGGCACTGATCACCTTGTGGTGGAACCGGATATGCCTGTCGATTCCATACAT
GGCCGCGGTGCTCTTGACGTACTCGAGGATGGGCTTGCCGTCGGCGATCGCCTGCCGTCCGGTCCAGGGACGGAATCGGA
AACCTAGCGTGTACATGTCGGAGTCGGAGCGAATTCCGGGATAACGGAACAAATCCCAGGTGCCGCCCATGGATTCCCGC
TTTTCCAGGATGGCGTAGCTCTTGGTCGGGCAACGGTCCTGCAGGTGCCAGGCCGCGCTGACACCGGAGATTCCAGCGCC
CACGATGACAACGTCGAGGTGCTCGGTCATG