Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_4089|Drugs|Mupirocin|Mupirocin-resistant_isoleucyl-tRNA_synthetase|MUPA ttgacaaagaaatatttaaacacccagaatgaaatatcagcattttggaatactcaaaagatatttaaaaaatcaattgacaatagaaaaggacaggaaagttttgttttttatgacggccccccaactgcaaatggccttcctcatgctggccatgttcttggaagagtaatcaaggatttagttgcaagattaaaaactatgcaaggtttttatgtagaaagaaaagcaggatgggatacccatggcttaccagttgaattagaggttgaaaaaaaaattggaattaaaggaaaacaagacattgaaaagtatggaatagaaaattttataaatgaatgtaaaaaaagtgtatttaattatgaaaaagaatggcgggatttttctaaagatttaggatactgggttgacatggactccccctatataactcttgagaataattatattgaaagtgtatggaatatattatctacattccataaaaaaggactattatataagggacataaggtgactccttattgtacacatgatcaaaccgctttaagttctcatgaagtagcgcaaggctataaaaacgttaaagatttatcagctgttgttaaatttcaacttacaaatagtaaagatacttatttcttaagttggactaccactccctggactttgcctgcaaatgtagcattagctataaataaagatcttaattattcaaaaattcgggtagaaaatgagtattatatcttagctacagatctaattaattctataataactgaaaaatacgaaattattgataccttttcaggaagtaatttaattaatttaaaatacattcctccttttgaaagcgacggtttagttaatgcatattacgttgttgatggagaatttgttactaactcagaaggaactggtattgttcatatagcaccagctcatggggaagatgactaccaattggttttagagcgtgatttggatttcttaaatgttataacaagagaaggagtatataatgataggttccctgaattagttggtaataaagctaaaaatagtgatatagaaatcataaaattattatccaaaaaacaacttttatataaaaaacaaaaatatgagcataattatcctcattgttggagatgtggtaatcctttgatatattatgcgatggaaggttggtttattaaaacaactaattttaagaatgaaattattaacaataataataatatagagtggtttccttctcatattaaggaagggagaatgggaaatttcttagaaaatatggttgattggaacattggtagaaatagatattggggaacaccattaaatgtatggatttgcaatgattgtaatcacgaatacgcaccaagtagtattaaggatttacaaaataattccatcaataaaattgatgaagatattgagttgcatagaccttatgttgataatatcactcttagttgccctaagtgtaatgggaaaatgtctcgagtagaagaagtaatcgatgtttggtttgatagcggctctatgccgtttgctcagcatcattatccttttgataaccagaaaatttttaatcaacactttccagctgattttattgcagaaggagttgatcaaacgagaggctggttttacagtttactagtaatttctactattctaaaaggaaaatcttcttataaacgtgctttatctttaggacatattctagacagtaatggtaaaaaaatgtctaaaagtaaaggaaacgttattaatccaactgaattaattaataagtacggagccgattctttaagatgggccttaatttcggatagtgctccatggaataacaaaagattctcagaaaatatagtagctcagaccaaatcgaaatttatagatacgcttgataatatttataaattttataatatgtataataaaatagatcactataatcctaataatgaaattacaaaaagtagaaatacattagataattgggctctttctcgcttaaacaccttaataaaagaaagtaatatttatgtaaataattacgatttcacttccgcagccagattaattaacgaatataccaatacaataagtaattggtatattcggagatcgagaggacgattttgggaacaaggaatttctaacgataaaaaagatgcgtacaatacgctttatgaaattttaacaactttatcaagactagtggctccatttgttccatttatatctgaaaaaatccattataatttgactggaaaaagtgtgcatttacaagattatccacaatataaagaaagttttattaatcaagcattggaagatgaaatgcataccgttataaaaattgtagaattatctagacaggctcgcaaaaatgcagatttaaaaattaagcaacctttatcgaaaatggtgattaaacctaatagtcaattaaacttaagttttttacctaattactattcaataataaaagacgaattaaatataaaaaacattgaattaactgataatattaatgactatattacctatgagcttaaattgaatttttcttctgtgggaccaaaactagggaacaaaacgaaaaatattcaaacattgatagactccctatcagagtatgataaaaaaagtttaattgagtctaataacttcaaaagtttatcttctgatgctgagttaactaaggatgattttataattaaaaccttacctaaggatagttatcaactcagtgaagataatgactgcgttatattattagataaaaatttatctcctgaattaattcgcgaaggacatgctagagagctcattagattaattcaacaattaagaaaaaagaaaaatttaccaataaatcaacgtattgatatttatatcggtgtaactggggaattattagaatcaataaaaaccaataaaaatatgtttaaagaaaatttgctgattaaaaatatacacttaaatgttatagatgaatatgaaaatactattcattttaataataaagaaataaaaatttccttattatattaa >>MEG_4090|Drugs|Mupirocin|Mupirocin-resistant_isoleucyl-tRNA_synthetase|MUPA TTGACAAAGAAATATTTAAACACCCAGAATGAAATATCAGCATTTTGGAATACTCAAAAGATATTTAAAAAATCAATTGACAATAGAAAAGGACAGGAAAGTTTTGTTTTTTATGACGGCCCCCCAACTGCAAATGGCCTTCCTCATGCTGGCCATGTTCTTGGAAGAGTAATCAAGGATTTAGTTGCAAGATTAAAAACTATGCAAGGTTTTTATGTAGAAAGAAAAGCAGGATGGGATACCCATGGCTTACCAGTTGAATTAGAGGTTGAAAAAAAAATTGGAATTAAAGGAAAACAAGACATTGAAAAGTATGGAATAGAAAATTTTATAAATGAATGTAAAAAAAGTGTATTTAATTATGAAAAAGAATGGCGGGATTTTTCTAAAGATTTAGGATACTGGGTTGACATGGACTCCCCCTATATAACTCTTGAGAATAATTATATTGAAAGTGTATGGAATATATTATCTACATTCCATAAAAAAGGACTATTATATAAGGGACATAAGGTGACTCCTTATTGTACACATGATCAAACCGCTTTAAGTTCTCATGAAGTAGCGCAAGGCTATAAAAACGTTAAAGATTTATCAGCTGTTGTTAAATTTCAACTTACAAATAGTAAAGATACTTATTTCTTAAGTTGGACTACCACTCCCTGGACTTTGCCTGCAAATGTAGCATTAGCTATAAATAAAGATCTTAATTATTCAAAAATTCGGGTAGAAAATGAGTATTATATCTTAGCTACAGATCTAATTAATTCTATAATAACTGAAAAATACGAAATTATTGATACCTTTTCAGGAAGTAATTTAATTAATTTAAAATACATTCCTCCTTTTGAAAGCGACGGTTTAGTTAATGCATATTACGTTGTTGATGGAGAATTTGTTACTAACTCAGAAGGAACTGGTATTGTTCATATAGCACCAGCTCATGGGGAAGATGACTACCAATTGGTTTTAGAGCGTGATTTGGATTTCTTAAATGTTATAACAAGAGAAGGAGTATATAATGATAGGTTCCCTGAATTAGTTGGTAATAAAGCTAAAAATAGTGATATAGAAATCATAAAATTATTATCCAAAAAACAACTTTTATATAAAAAACAAAAATATGAGCATAATTATCCTCATTGTTGGAGATGTGGTAATCCTTTGATATATTATGCGATGGAAGGTTGGTTTATTAAAACAACTAATTTTAAGAATGAAATTATTAACAATAATAATAATATAGAGTGGTTTCCTTCTCATATTAAGGAAGGGAGAATGGGAAATTTCTTAGAAAATATGGTTGATTGGAACATTGGTAGAAATAGATATTGGGGAACACCATTAAATGTATGGATTTGCAATGATTGTAATCACGAATACGCACCAAGTAGTATTAAGGATTTACAAAATAATTCCATCAATAAAATTGATGAAGATATTGAGTTGCATAGACCTTATGTTGATAATATCACTCTTAGTTGCCCTAAGTGTAATGGGAAAATGTCTCGAGTAGAAGAAGTAATCGATGTTTGGTTTGATAGCGGCTCTATGCCGTTTGCTCAGCATCATTATCCTTTTGATAACCAGAAAATTTTTAATCAACACTTTCCAGCTGATTTTATTGCAGAAGGAGTTGATCAAACGAGAGGCTGGTTTTACAGTTTACTAGTAATTTCTACTATTCTAAAAGGAAAATCTTCTTATAAACGTGCTTTATCTTTAGGACATATTCTAGACAGTAATGGTAAAAAAATGTCTAAAAGTAAAGGAAACGTTATTAATCCAACTGAATTAATTAATAAGTACGGAGCCGATTCTTTAAGATGGGCCTTAATTTCGGATAGTGCTCCATGGAATAACAAAAGATTCTCAGAAAATATAGTAGCTCAGACCAAATCGAAATTTATAGATACGCTTGATAATATTTATAAATTTTATAATATGTATAATAAAATAGATCACTATAATCCTAATAATGAAATTACAAAAAGTAGAAATACATTAGATAATTGGGCTCTTTCTCGCTTAAACACCTTAATAAAAGAAAGTAATATTTATGTAAATAATTACGATTTCACTTCCGCAGCCAGATTAATTAACGAATATACCAATACAATAAGTAATTGGTATATCGGAGATTCGAGAGGACGATTTTGGGAACAAGGAATTTCTAACGATAAAAAAGATGCGTACAATACGCTTTATGAAATTTTAACAACTTTATCAAGACTAGTGGCTCCATTTGTTCCATTTATATCTGAAAAAATCCATTATAATTTGACTGGAAAAAGTGTGCATTTACAAGATTATCCACAATATAAAGAAAGTTTTATTAATCAAGCATTGGAAGATGAAATGCATACCGTTATAAAAATTGTAGAATTATCTAGACAGGCTCGCAAAAATGCAGATTTAAAAATTAAGCAACCTTTATCGAAAATGGTGATTAAACCTAATAGTCAATTAAACTTAAGTTTTTTACCTAATTACTATTCAATAATAAAAGACGAATTAAATATAAAAAACATTGAATTAACTGATAATATTAATGACTATATTACCTATGAGCTTAAATTGAATTTTTCTTCTGTGGGACCAAAACTAGGGAACAAAACGAAAAATATTCAAACATTGATAGACTCCCTATCAGAGTATGATAAAAAAAGTTTAATTGAGTCTAATAACTTCAAAAGTTTATCTTCTGATGCTGAGTTAACTAAGGATGATTTTATAATTAAAACCTTACCTAAGGATAGTTATCAACTCAGTGAAGATAATGACTGCGTTATATTATTAGATAAAAATTTATCTCCTGAATTAATTCGCGAAGGACATGCTAGAGAGCTCATTAGATTAATTCAACAATTAAGAAAAAAGAAAAATTTACCAATAAATCAACGTATTGATATTTATATCGGTGTAACTGGGGAATTATTAGAATCAATAAAAACCAATAAAAATATGTTTAAAGAAAATTTCGTGATTAAAAATATACACTTAAATGTTATAGATGAATATGAAAATACTATTCATTTTAATAATAAAGAAATAAAAATTTCCTTATTATATTAA