Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

CZCCM

The CZCCM group of genes confer resistance to Metal resistance through the mechanism, Metal resistance MFS efflux regulator.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Multi-metal RND efflux regulator

    Sequences

    Download Sequences

    >>MEG_2466|Metals|Multi-metal_resistance|Multi-metal_RND_efflux_regulator|CZCCM
    ATGCGAAGACTATTTCTGCCGCTCGGGCTGGCGGTAGCATTTCTCAGCCCAAACTTTGCCGTAGCGCAATCTGACACCGG
    CACGTCCATGGTGCCCGTCTTCCCAAGGGAAGCGGCGGGACCGTTGACCCTCGAGGCCGCGTTGTCGCTGGCGGCAGGAA
    GCAATTTCAACCTGTCCGCCGCCGCCAAGGAACTCGATTCCACAGAAGGTGGGATCATGCAGGCCCGGGTTATTCCGAAC
    CCGGAACTCAAGACGCTGGTCGAGGACACGCGGAAATCCACCCGTACATCCACCGCCCAGATGAATATCCCCATCGAACT
    GGGCGGCAAGCGCTCGGCTCGTATCAATGCCGCGGAAAGGACGCGCGAACTGGCGCAGGCAACGCTGGCTGGCGTTCGCG
    GTGACATTCGGGCGCAGGTAATCGAGAGCTTTTTTTCCGTCTTGATCGCACAGGAACGCGTCAAGCTGGCAACTGGCTCC
    GCGGATATCGCTGCGAGGGGCGCGCAAGCCGCTTCACGCCGCGTCGCGGCCGGCAAGATCTCCCCGGTTGACGAAACTAA
    GGCACGTGTCGAACAGGCCAACGCCGAACTTGAATTGGCCGAAGCAACGGCGAGCCTGCAGTCCGCCCGTCAGGCGTTGA
    CGGCGTTGTGGGGCAATGCATCGCCGCAGTTTGCCGAAGCACAGGGCAATCTGGACGCGCTGCCATCCAGGCCGGCGCCT
    GAACTCCTTCAGAAGGAGCTGGAAAACTCACCGCTGGTGGCCGCAAGCCGCGCTGAACTTGACCGCCGCCAGGCATTGGT
    GGGCGTTGAGCGCAGCCGCCAGTATCCGGATCTGACAGTCAGTCTGGGTGCCAAGCGAGATACAGAAGCCAACCGCAACA
    TGGCGGTGATCGGTGTGGCGATCCCGTTGCCGATTTTTGACCGGAATCAGGGCAACTTGTATTCGGCCATTCGCCAGGCG
    GACAAGGCCCAGGATGAATATCTGGCCAATCGCATCAGCCTGACCCGAAATCTCCTGATGGCATCGAACCAGCTGTCGGT
    ATCGCGCGCCTCGGCACAAACGCTGAAGCAGACCGTCTTGCCAGGCGCCGAGCAAGCCTTCAACGCGGCGACCATTGGCT
    TCGAGGCCGGCAAGTTCAATTATCTGGACGTCCTGGATGCCCAGCGCACGCTGTTCCAGGCACGCATCCGCTATCTCGGC
    GTGCTTGGACAAACCTATCAGGCGGCGACCACGATCGATCGCATTCTGGGACGTTAA

    >>MEG_2467|Metals|Multi-metal_resistance|Multi-metal_RND_efflux_regulator|CZCCM
    TTGACCCTCGAGGCCGCGTTGTCGCTGGCGGCAGGAAGCAATTTCAACCTGTCCGCCGCCGCCAAGGAACTCGATTCCAC
    AGAAGGTGGGATCATGCAGGCCCGGGTTATTCCGAACCCGGAACTCAAGACGCTGGTCGAGGACACGCGGAAATCCACCC
    GTACATCCACCGCCCAGATGAATATCCCCATCGAACTGGGCGGCAAGCGCTCGGCTCGTATCAATGCCGCGGAAAGGACG
    CGCGAACTGGCGCAGGCAACGCTGGCTGGCGTTCGCGGTGACATTCGGGCGCAGGTAATCGAGAGCTTTTTTTCCGTCTT
    GATCGCACAGGAACGCGTCAAGCTGGCAACTGGCTCCGCGGATATCGCTGCGAGGGGCGCGCAAGCCGCTTCACGCCGCG
    TCGCGGCCGGCAAGATCTCCCCGGTTGACGAAACTAAGGCACGTGTCGAACAGGCCAACGCCGAACTTGAATTGGCCGAA
    GCAACGGCGAGCCTGCAGTCCGCCCGTCAGGCGTTGACGGCGTTGTGGGGCAATGCATCGCCGCAGTTTGCCGAAGCACA
    GGGCAATCTGGACGCGCTGCCATCCAGGCCGGCGCCTGAACTCCTTCAGAAGGAGCTGGAAAACTCACCGCTGGTGGCCG
    CAAGCCGCGCTGAACTTGACCGCCGCCAGGCATTGGTGGGCGTTGAGCGCAGCCGCCAGTATCCGGATCTGACAGTCAGT
    CTGGGTGCCAAGCGAGATACAGAAGCCAACCGCAACATGGCGGTGATCGGTGTGGCGATCCCGTTGCCGATTTTTGACCG
    GAATCAGGGCAACTTGTATTCGGCCATTCGCCAGGCGGACAAGGCCCAGGATGAATATCTGGCCAATCGCATCAGCCTGA
    CCCGAAATCTCCTGATGGCATCGAACCAGCTGTCGGTATCGCGCGCCTCGGCACAAACGCTGAAGCAGACCGTCTTGCCA
    GGCGCCGAGCAAGCCTTCAACGCGGCGACCATTGGCTTCGAGGCCGGCAAGTTCAATTATCTGGACGTCCTGGATGCCCA
    GCGCACGCTGTTCCAGGCACGCATCCGCTATCTCGGCGTGCTTGGACAAACCTATCAGGCGGCGACCACGATCGATCGCA
    TTCTGGGACGTTAA

    >>MEG_2468|Metals|Multi-metal_resistance|Multi-metal_RND_efflux_regulator|CZCCM
    ATGCGAAGACTATTTCTGCCGCTCGGGCTGGCGGTAGCATTTCTCAGCCCAAACTTTGCCGTAGCGCAATCTGACACCGG
    CACGTCCATGGTGCCCGTCTTCCCAAGGGAAGCGGCGGGACCGTTGACCCTCGAGGCCGCGTTGTCGCTGGCGGCAGGAA
    GCAATTTCAACCTGTCCGCCGCCGCCAAGGAACTCGATTCCACAGAAGGTGGGATCATGCAGGCCCGGGTTATTCCGAAC
    CCGGAACTCAAGACGCTGGTCGAGGACACGCGGAAATCCACCCGTACATCCACCGCCCAGATGAATATCCCCATCAGACT
    GGCGGCAAGCGCTCGGCTCGTATCAATGCCGCGGAAAGGAACGCGCGAACTGGCGCAGGCAACGCTGGCTGGCGTTCGCG
    GTGACATTCGGGCGCAGGTAATCGAGAGCTTTTTTTCCGTCTTGATCGCACAGGAACGCGTCAAGCTGGCAACTGGCTCC
    GCGGATATCGCTGCGAGGGGCGCGCAAGCCGCTTCACGCGTCGCGGCCGGCAAGATCTCCCCGGTTGACGAAACTAAGGC
    ACGTGTCGAACAGGCCAACGCCGAACTTGAATTGGCCGAAGCAACGGCGAGCCTGCAGTCCGCCCGTCAGGCGTTGACGG
    CGTTGTGGGGCAATGCATCGCCGCAGTTTGCCGAAGCACAGGGCAATCTGGACGCGCTGCCATCCAGGCCGGCGCCTGAA
    CTCCTTCAGAAGGAGCTGGAAAACTCACCGCTGGTGGCCGCAAGCCGCGCTGAACTTGACCGCCGCCAGGCATTGGTGGG
    CGTTGAGCGCAGCCGCCAGTATCCGGATCTGACAGTCAGTCTGGGTGCCAAGCGAGATACAGAAGCCAACCGCAACATGG
    CGGTGATCGGTGTGGCGATCCCGTTGCCGATTTTTGACCGGAATCAGGGCAACTTGTATTCGGCCATTCGCCAGGCGGAC
    AAGGCCCAGGATGAATATCTGGCCAATCGCATCAGCCTGACCCGAAATCTCCTGATGGCATCGAACCAGCTGTCGGTATC
    GCGCGCCTCGGCACAAACGCTGAAGCAGACCGTCTTGCCAGGCGCCGAGCAAGCCTTCAACGCGGCGACCATTGGCTTCG
    AGGCCGGCAAGTTCAATTATCTGGACGTCCTGGATGCCCAGCGCACGCTGTTCCAGGCACGCATCCGCTATCTCGGCGTG
    CTTGGACAAACCTATCAGGCGGCGACCACGATCGATCGCATTCTGGGACGTTAA