MEGAResFrom MEG, the Microbial Ecology Group

TAP

The tap gene encodes an efflux pump in Mycobacterium fortuitum.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>223|AJ000283.1|AJ000283|Multi-drug_resistance|Multi-drug_efflux_pumps|TAP
ATGACGAACACCAAGCGCGGCCCCTTGCTGCTGATCCTGTTCGCCGCGTTGACGGCCGGCGCCGGCAACGGAATCACCAT
CGTCGCGTTCCCGTGGCTGGTGTTGCAGCACAACGGATCCGCGCTCGACGCCTCGATCGTCGCGATGGCCGGCACCCTGC
CGCTGCTGGTGGCCACACTGATCGCCGGGGCGGCGGTGGATTACCTGGGTCGCCGACGGGTTTCGATGATCTCGGATCTG
CTCTCGGCGCTGTCGGTCGCTGCGGTACCCGTGCTGGCCCTGATTTTCGGGGTGGACGCGGTCAATGTCGCGGTGCTGGC
GGTCCTGGCGGGGCTGGGAGCGTTCTTCGACCCGGCCGGCATGACAGCGCGCGAGACCATGCTGCCCGAGGCCGCGGGCC
GGGCCGGTTGGACGCTGGACCATGCCAACTCGGTGTACGAGGCGGTCTTCAACCTGGGCTACATCGTCGGCCCCGGTATC
GGCGGCCTGATGATCGCCACGCTCGGCGGGATCAACACCATGTGGGTGACGGCCGGGGCGTTCTGCTGCTCGATCCTGGC
CATCTCGGTGCTGCGACTGGAGGGCGCGGGCGCGCCGGACCGCTCGGTGCTGACCGAGGCCGTTTTGGCGGGCATAGTCG
AGGGACTGCGATTCGTCTGGTACACACCGGTATTGCGCACCCTGGCCATCGTCGACCTGGTGGCCACCGGCTTGTACATG
CCGATGGAATCGGTCCTTTTTCCGAAGTACTTCACGGACCGGAACGAACCCACCGAACTGGGCTGGGTGCTGATGGCGTT
GAGCATCGGCGGACTGTTGGGTGCGCTCGGTTACGCCGTGATGTCCAGGTACATGAGCCGACGGGCCACCATGCTGACCG
CCGTGATCACCCTCGGGGTGGCGATGACGGTGATCGCCTTCCTGCCACCGCTGCCGCTGATCCTGGTGCTGTGCGCAATC
GTCGGCTTCGTCTACGGACCGATCGCACCCATCTACAACTACGTCATGCAGACCACCGCTCCCCAACACCTGCGTGGCCG
CGTGGTCGGGGTGATGGGCTCATTGGCCTACGCCGCGGGCCCGCTCGGGCTGATCCTGGCCGGGCCGCTGGCCGACGCCG
CAGGCCTGCACGCGACGTTCCTGGCACTGTCCCTACCGATGCTGTTGCTCGGCGTCGTGGCGGTGTTCCTGCCGCGGCTG
CGCGAGCTGGACCTAGCATCGAAACCGTGA