MEGAResFrom MEG, the Microbial Ecology Group

SAV1866

The sav1866 gene encodes an ATP-binding cassette multi-drug efflux pump in Staphylococcus aureus.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|NC_002951|1987719-1989456|ARO:3000489|sav1866|Multi-drug_resistance|Multi-drug_efflux_pumps|SAV1866
TTATAAGTTTTGAATGCTATATAAATGCTCGTAAGCACCTTGTTTTGCAATCAATTCACGATGCGTACCTGTTTCAACAA
TATGTCCATTTTCAATTACGACAATTTTGTCAGCATGTGTAATAGTGGACAAGCGATGCGCTACGATAAGTGTCGTTCGA
TCTTTACTCAACACATCTAATGCTTCTTGAATAATGGATTCACTTTCTAAATCAAGTGCACTTGTTGCTTCATCCAAGAT
AAGAATTGGCGGATTATTTAAAAATATTCTAGCAATCGATAATCTTTGTTTTTGACCACCTGATAATTTAACACCTCGTT
CACCTACTTCAGTGTCATATCCCTGTGGCAAGTTCATAATAAAGTCATGTGCATTAGCCATTTTCGCCGCTTCAACTACT
TCTTCATCTGTTGCTGTTGGACGACCAAGTAAAATATTTTCCTTAACTGTATCAGAGAATAAAATATTATCCTGTTGCAC
CAATCCTATTTGATTTCTTAAACTTCCCGTTAAAAAATCTTTAATGTTGTGACCATCTATTAAAATTTGCCCAGAAGTTA
CATCGTAAAATCTCGGTATTAAGTTAATTAATGTTGATTTACCACCACCACTCATACCTACGAAAGCAACTGTTTCTCCT
TTTTCAATACTCAAATTAATATCTTTTAAAATTGGAGCTTCGTTATCGTTATATTGAAAACTAACATGATCAATATCAAT
ACGACCTTGTTTAATTTCAATAGGTTGAGCACCAACACCATTTTTGATGTCATAATCTTCATCAATTAATTGGAATACAC
GGTCCATTGAAGCAAAACTTTGCGTTAAAGTTGTAAATGATGCGACTAAACGACGTAAAGGCCCGAACAATAACTCTAAG
TATCCAACAAATGCTGCAAGTGTACCTACTGTGATTGATCCAGAAATAGCAAGATATGCACCAACACCGATGACAATAAT
TGGTCCAATATCTGTAACTGTATTAATTGCGGCAAAGGAATAGGCATTCCATCTTGTATGTTTCAACGCACGTGTTAGGA
AATTAGTATTCTTTTTATCAAAGTTTTTCGCTTCATTGTCTTCAATCGCAAAACTTTTAACGACTGAAATACCTTGAACA
CGTTCATGCAAGAATCCTTGAACCTCAGCTAATGCTTGAGATCTTTCACGTGTCAATTTTCTTAATCTTCCAAAGAAAAC
GTACACCGTTAAAATGTAAAATGGGAAGATAAACAGTGCTGCTAAAGTCAATTTCACATCTAAAAAGAACATTATGGATA
GTGCAATAATAATTGTTATACAATCTAACCAAATATTCATTAACCCGGTTAAAATGAAATCTTTTGTTTGTTCAACATCA
TTAATCACTCTAGATATTACTTGACCTACTTGATTATTAGCATAAAATCTCGCACTTAAAGCTTGTAAATGGTTGTATAA
CTTTTTACGTATATCATACAATATTTTATTACTTGTCCATTGCGCCAAATATTGACGTATAAATTCAATTGGTGGTCTCA
CTATTACAAAAATAAATAATGCGATACCAATGGCAATAGTTAAATGATGAACTTTTTCATCAGTCGTTAGTGCGTGGTTA
TTAATCACGCCATCTATTGCATATTTAATTAATAGTGGTATAAGCATTGGTATACCAAACTTAATTATCCCAACAATAAT
CGTTGCAAAAATACGATATTTGTATGGCTTAACAAATTGCAAATATCGTTTAATCATA