MEGAResFrom MEG, the Microbial Ecology Group

NORB

The norB gene encodes a multi-drug efflux pump that is independent of norA. It can act on fluoroquinolones, therefore causing resistance.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|HE999704|2734780-2736181|ARO:3000421|norB|Multi-drug_resistance|Multi-drug_efflux_pumps|NORB
CTATTCTTTTGCGGCTTTTAATTCGAGCGCTTTTTTCGCAGATGGTGTTGTTATAGCAACGGAAATAAGTGAAACGACAC
AAAAACCGACGTTCGTTAAAAGCCCCACCATTGCGGCTAAATCAATATTTCCTGAAAGTGCAATCACACCATAAATCGTA
GCAGATATCGCCACGCCGAATGAGCCACCTAGCGAACTTGCCATTTTGTAAATACCAGATGCTACTCCGACTTTATCTTC
TGGAGCATTAGAAATGGCTGTATCTGTTGAAGGAGTCGCATACATGCCAAGTCCAATCCCGAATAAAGCAAAACCGATAA
ATACAAGCACTGTATAAAGGGTTCCCGGAATAAACGTCAGCGCCATTAGTGCAATACCAACAGCCGTAATACCAGAGCCT
AAAATCATTGGTTTACGCGCACCAACACGTTGAAGAATTTTTTCACCGATGCGAATCATTCCGAGCACACAGACAAGATA
TCCGATAGAAAGTAAACCGGATTGGAACGCCGTAAAACCGCGACCAATTTGCACATAAGTGTTTGCGACAACCAGTGTTC
CAGCTGCTGCGTTTAGCAAGAAGTTCGAAAGTGTTGCGCCTGTATAAGCTTTATTTTTAAATAACGAGAAATCAATAAAT
CCGTTTGCTTGTCGCAGTTCCACTCGGAAGAATAATCCCGCAGAAACTAGGAAAACAACGAGCATTGTAATAGTAATTGG
GCTTGTCCAGCCAAATGTTGCGCCACGAGTAATAATAAGGTTCAAACAAACCATTGCGATAACAAAAAGAACAAGACCAA
ATGAATCAAATTTTGCTTTTGTATTTTGAACGACTTTACTTTCTGGAGTACCTTTAATAAGTAGCATTCCAAGCAGTGCG
AATACGATGGAAATAATGAAAATCCAGCGCCAGCCCATATATGTTGCGATAGCGCCACCTGCGAACGAACAAATACCTGA
TCCGCCCCATGAGCCAATTGACCAGTAACTAAGTGCTCTTTGTCTATCTGCCCCGTCAAAATAAGTTTTCATTAAGGCAA
GGGTTGCTGGCATAATACAAGCAGCTGAAAGACCTTGAATAATCCGGCCGATAATAAGTAGCGTCGACCCTTGAGTGACA
ACAAGTAGCAGTGAACCGATGATACTAAGAATAAGTCCGATATAAGTTAATTTCACACGACCAAATTTGTCAGCCATCCC
ACCTGCTACAACGATAAAAATACCTGAAAATAGCGCGGTTAAACTGATGGCAATACTAAGTAAATCAGAGGAAATTCCAA
GGTCAGATTGCACGGCCGGAACAATATTCACCATAGATTGAGCAAAAAGCCAAAACGTGATAACCCCGAAAACAATTCCA
ACGATTAGTTTATTTGTACCTTTATACGCTGTTGAAGTCATT

>Flq|HE999704.1|gene3170|Multi-drug_resistance|Multi-drug_efflux_pumps|NORB
ATGACTTCAACAGCGTATAAAGGTACAAATAAACTAATCGTTGGAATTGTTTTCGGGGTTATCACGTTTTGGCTTTTTGC
TCAATCTATGGTGAATATTGTTCCGGCCGTGCAATCTGACCTTGGAATTTCCTCTGATTTACTTAGTATTGCCATCAGTT
TAACCGCGCTATTTTCAGGTATTTTTATCGTTGTAGCAGGTGGGATGGCTGACAAATTTGGTCGTGTGAAATTAACTTAT
ATCGGACTTATTCTTAGTATCATCGGTTCACTGCTACTTGTTGTCACTCAAGGGTCGACGCTACTTATTATCGGCCGGAT
TATTCAAGGTCTTTCAGCTGCTTGTATTATGCCAGCAACCCTTGCCTTAATGAAAACTTATTTTGACGGGGCAGATAGAC
AAAGAGCACTTAGTTACTGGTCAATTGGCTCATGGGGCGGATCAGGTATTTGTTCGTTCGCAGGTGGCGCTATCGCAACA
TATATGGGCTGGCGCTGGATTTTCATTATTTCCATCGTATTCGCACTGCTTGGAATGCTACTTATTAAAGGTACTCCAGA
AAGTAAAGTCGTTCAAAATACAAAAGCAAAATTTGATTCATTTGGTCTTGTTCTTTTTGTTATCGCAATGGTTTGTTTGA
ACCTTATTATTACTCGTGGCGCAACATTTGGCTGGACAAGCCCAATTACTATTACAATGCTCGTTGTTTTCCTAGTTTCT
GCGGGATTATTCTTCCGAGTGGAACTGCGACAAGCAAACGGATTTATTGATTTCTCGTTATTTAAAAATAAAGCTTATAC
AGGCGCAACACTTTCGAACTTCTTGCTAAACGCAGCAGCTGGAACACTGGTTGTCGCAAACACTTATGTGCAAATTGGTC
GCGGTTTTACGGCGTTCCAATCCGGTTTACTTTCTATCGGATATCTTGTCTGTGTGCTCGGAATGATTCGCATCGGTGAA
AAAATTCTTCAACGTGTTGGTGCGCGTAAACCAATGATTTTAGGCTCTGGTATTACGGCTGTTGGTATTGCACTAATGGC
GCTGACGTTTATTCCGGGAACCCTTTATACAGTGCTTGTATTTATCGGTTTTGCTTTATTCGGGATTGGACTTGGCATGT
ATGCGACTCCTTCAACAGATACAGCCATTTCTAATGCTCCAGAAGATAAAGTCGGAGTAGCATCTGGTATTTACAAAATG
GCAAGTTCGCTAGGTGGCTCATTCGGCGTGGCGATATCTGCTACGATTTATGGTGTGATTGCACTTTCAGGAAATATTGA
TTTAGCCGCAATGGTGGGGCTTTTAACGAACGTCGGTTTTTGTGTCGTTTCACTTATTTCCGTTGCTATAACAACACCAT
CTGCGAAAAAAGCGCTCGAATTAAAAGCCGCAAAAGAATAG