MEGAResFrom MEG, the Microbial Ecology Group

MSBA

The msbA gene encodes a multi-drug efflux system in Vibrio cholera.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>63|DQ516954.1|DQ516954|Multi-drug_resistance|Multi-drug_efflux_pumps|MSBA
GAAGCATAAATGGGTTGCCTTATTCTCAATCGTTTCAACCTTTATTTATGCAGGAGTACAGCTTTACCAACCCCAAATCA
TGAAACGAATTATGACCGTAATGTCATCAACAACTTATAGCCGTCATCAAATGGCTGACAAGGTTTCAGGATATGGAGTT
GAGCTTTTGGTTGTTGCTGGGATAGGGATAATTTTTGCTATCTTTAGTACACTTTCAGCGGCACGTATTGCCCAAGAAAT
TGGAGCAGACGTTCGTGAAGCGACTTACAAAAAAATCAATACATTTTCTTATGAAAATGTTGAAAAGTTCAATGCCGGAA
ACCTTGTTGTTCGGATGACAAATGACGTCACACAAGTTCAAAACTTGATGATGATGGTTTTCCAAATTTTGATGCGGATT
CCAGTCCTTTTGATTGGTGCGGTTGTTCTTTCTATCACAACTCTTCCAAGATTATGGTGGATTACAGTCCTTTTAATTGT
TTTAATCGTATTAGTCACAGCCGTTTTAATGGGACGCATGGGCCCTCACTTTATGGCTTTCCAAAAATTGATGGACCGTA
TTAACGCCATTGCTAAACAAAACTTGCGTGGTTCACGTGTCGTTAAATCATTCGTTCAAGAAAAAAATCAAATCAAAGAT
TTTGATGAAACTTCTGATGAACTTTACGATCATAACTGGGCAGTAGGAAAACTCTTCTCAGCAATGATTCCACTCTTTAC
TGTGATTGCTCAAGGAGCAATTTGGCTTGCTATTTACTTTGTTTCAACTTTTGTAACAGAGTCAACAACAGTTGCCCAAG
ATAGTATTGGTGGGATTGCTACATTCATGACTTATATGGGAATGATTATGTTTGCCATTATCATGGGTGGTATGATTTCA
ATGTTTGCTTCACGTGGTATGGTATCAATTGGTCGTATTAATGAAGTGTTAAATACTGATCCAGCCATGAAATTTGATGA
AAATGCTAAAGATGAAGTTCTTTCAGGTTCTGTCAAATTTGACCATGTGTCATTCTCTTATCCAAATGATGAAGAACCAA
CACTTAAAGATATTAGCTTTGAAGTAGAACCTGGTCAAATGGTTGGGATTGTCGGAGCGACTGGTGCTGGTAAATCTACA
TTGGCACAATTGATTCCAAGACTCTTTGACCCAACAGAAGGTACCGTTTCAGTTGGTGGAAAAGATCTTAAAACAGTTAG
CCGTGGAACATTGAAGAAAAATATTTCTATTGTTCTTCAAAAAGCCATTCTCTTCTCAGGAACAATTGCTGGAAATATTA
AACAGGGGAAAGCCGATGCAACTGATGAAGAAATGACTCGTGCTGCACGCATTGCCCAAGCCGCAGAATTTATTACAACT
AAAGATGGTCAATATGATTCTGAAGTTGAAGAACGCGGAAATAACTTCTCAGGTGGTCAAAAGCAAAGACTTTCAATCAC
ACGTGGAGTTGTTAAAAATCCAAATGTCTTAATTTTAGATGACTCAACATCAGCCCTTGATGCTAAATCTGAAAAACTTG
TTCAAGAAGCTTTGAATAAAGACCTTAAAGACACAACCACAATTATTATTGCTCAAAAGATTTCATCAGTGGTTCATGCA
GATAATATTTTGGTTCTTGACCAAGGAAAACTTGTTGGTCAAGGAACTCACCAAGAATTAGTTGCTGAGAATAAAATTTA
CCAAGAAATCTACGACACACAGAAAGCACAGGAGGAC

>38|DQ516970.1|DQ516970|Multi-drug_resistance|Multi-drug_efflux_pumps|MSBA
GAAAATACCAAATCAACAAGAAAAATGTCTGACACCACACGTGCCATCCGATTTTTTTACCTCTATCTGAAAAGATATAA
ACTCCAATTTGCTGTAATTATGATTTTCATCATTTTAGCAACTTGGTTACAGGTTGTTTCTCCATCACTTTTGGGGGACG
CCATCACTAATTTGACTAAATATGTGACTGACTTCTTTACACATCAACATGCTGGTCAATCCCAAGATGCACTACAACAA
ATTGCTCAACAATTAAGCCAACAAATGCACCAAACAGTAGATTGGCACAATGTTCCTGAAGTTGTGAAATCTTTGCCACA
AGCAGCACAAGACCAAATCACTGCTAATCTTCCTAAAGGAACAACTTTAGAAACACTTAAAACAGTGGCAACTTCACATG
CAGCCAGCACTTCTACATTCATGAAAGGAATGTGGCAATTGCTTGCAGTCTATGTAGCAACAGGTGTATCAATGTTGATT
TATACCTTGCTCTTTAGTCGTATCGTTGCTCATTCAACAAATCGCATGCGTAAAGGTTTGTTTGGTAAACTTGAACGTTT
GACAATTTCATATTTTGACCGTCATCAAGATGGTGATATCCTTGCTCGTTTCACATCTGACTTGGATAACATTCAAAATA
CTTTAAACCAAGCACTCGTTTCGGTTATTTCAAATGCTGCGGTCTTTGTGGGTGTCATTATCCAGATTTTCAATAAAGAT
GTGACATTTGCTTGGTTGACAGTTGCTGCTTCTCCAGTTGCCATTTTATCTGCTGTGATTATCATTCGTCAATCGAAAAA
AGCAACAGACAAACAACAAGAAGAAGTTTCACAACTTAATGCCTATATGGATGAAAAAATCTCTGGGCAAAAAGCAATTA
TCGTTGAAGGTTTACAAGAAGATTCTATTAATGGATTCTTGGAACACAATGAAAATGTTAAAAAACGTACCTTTGCTGCT
CAAGCATGGTCTGGTATGATTTTCCCATTGATGAATGGTTTCCAACTTTTATCAATTGCCATTGTTATCTTTGGTGGAAC
GGCCTATGTTCTTAACGATGATAGCATGTCAATTGCCACAGGTTTAGGGCTTTTGGTTGCCTTTGTTCAATACGTTCAAA
GTTACTACAACCCAATCATGCAAATTTCATCAAACTTTGGTCAACTTCAACTTGCCATCACAGGGGCAACTCGTCTGAAT
GTCATGTTTGATGAACCAGAAGAAGTTCGTCCTGAAAATGGTAAGAAATTTGATACGATTAAAGACGGAATTCAAATCGA
AAATCTTGATTTTGAATATCTTCCAGGAAAACCAGTCCTCAAAAAAGTTAATATTGATGTTAAAAAAGGACAAATGGTTG
CCCTCGTTGGTCCAACTGGTTCAGGTAAAACAACAGTTATGAACTTGATGAACCGTTTCTACGATGTTAATGGTGGAGCA
ATTAAATTTGATGGAACTGATATTCGTGAATTTGATTTAGATAGCTTGCGTTCAAATGTCGGAATTGTTTTGCAAGAGTC
TGTTCTCTTTGATGGAACGATTGCTGATAATATCAAGTTTGGTAAACCAAATGCTACTCAAGAAGAAATTGAAACAGTGG
CTAAGACAACTCACATTCATGATTTCATTGATAGCTTACCTGACAAGTACGAAACACATGTTTCAGATGATGAATCAGTC
TTCTCAGTTGGTCAAAAACAACAAATTTCTATCGCACGTACCATTTTGACAAATCCAGAACTTTTGATTTTGGATGAAGC
AACTTCAAATGTGGATACAGTAACTGAACAACAAATTCAATGGGCGATGGAAGCTGCTATTGCTGGTCGTACTTCATTCG
TTATTGCTCACCGTTTGAAAACAATTCTTAATGCAGATAAGATTGTTGTTCTTAAAGATGGTGAAGTTATCGAAGAAGGA
AATCACCATGAACTTGTTGCTCAAGGTGGCTTCTACTCTGAACTTTATCACAATCAATTTGTTTTTG