MEGAResFrom MEG, the Microbial Ecology Group

MEXH

The mexG-mexH-mexI-opmD is a 4-member gene group that encodes an efflux system in Pseudomonas aeruginosa.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>Mdr|NC_002516.2.880450|Multi-drug_resistance|Multi-drug_efflux_pumps|MEXH
ATGCAGAAACCCGTCCTGATCGCCAGTGCCGCGCTCATCTGCGCGGCGGTTATCGGCATCGCCGTCTACGCCACCGGCTC
GGCGAAGAAAGACGCCGGCGGTTTCGCCGGCTACCCGCCGGTGAAGGTCGCCCTCGCCTCGGTGGAGCGGCGGGTGGTGC
CGCGCGTCTTCGATGGCGTCGGCGAGCTGGAGGCCGGTCGCCAGGTCCAGGTGGCCGCCGAAGCGGCAGGACGGATCACC
CGCATCGCCTTCGAATCGGGCCAGCAGGTGCAGCAAGGGCAGTTGCTGGTGCAACTCAACGACGCGGTGGAACAGGCCGA
GCTGATCCGTCTCAAGGCGCAGTTGCGCAATGCCGAGATCCTCCATGCCCGTGCGCGCAAGCTGGTAGAGCGCAACGTCG
CCTCGCAGGAACAGCTGGACAACGCCGTCGCCGCCCGCGACATGGCGCTCGGCGCGGTGCGCCAGACCCAGGCGCTGATC
GACCAGAAGGCGATCCGCGCGCCCTTCTCCGGCCAGCTCGGCATCCGCCGCGTGCACCTCGGCCAGTACCTCGGCGTCGC
CGAGCCGGTGGCCAGCCTGGTGGATGCGCGGACCCTGAAAAGCAATTTCTCCCTGGACGAAAGCACCAGTCCCGAGCTGA
AGCTCGGCCAGCCCCTCGAGGTCCTGGTCGACGCCTATCCGGGGCGCAGCTTCCCGGCGCGCATCAGCGCCATCGACCCG
CTGATCGGCAAGTCGCGCACGGTGCAGGTCCAGGCCTTGCTGGACAACCCCGAAGGCCTGCTCGCCGCCGGCATGTTCGC
CAGCATCCGGGTCTCGCGCAAAGCCGACGCGCCGTCGCTGAGCGTGCCGGAAACCGCGGTCACCTATACCGCCTACGGCG
ACACCGTGTTCGTCGCCCACCAGGACGGCGACCGGCCGCTCAGCGCCAAGCGCGTCTCGGTGCGGATCGGCGAGCGCTGG
GACGGTCGCGTGGAAATCCTCCAGGGCCTCGCCGAGGGCGACCGGGTAGTGACTTCCGGACAGATCAACCTGAGCGACGG
GATGGCCGTGGAACCGGTCAAGGAAGACACCCTGAGCAGTGCCGCGCCCCCCGTGCCGGTCGCCGGCCGCTGA