MEGAResFrom MEG, the Microbial Ecology Group

MEXG

The mexG-mexH-mexI-opmD is a 4-member gene group that encodes an efflux system in Pseudomonas aeruginosa.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|NC_002516|4705955-4706402|ARO:3000806|mexG|Multi-drug_resistance|Multi-drug_efflux_pumps|MEXG
ATGCAGCGCTTCATCGATAACTCGCTCGAAAGCAACTGGCTCTGGCTGACCGCCCGGATCTGCCTGGCCCTGATGTTCGT
CGCCTCGGGACTGGCGAAGCTGTTCGACTATCAGGCCAGCCTGGAGGAAATGCGCGCCGCCGGCCTGGAGCCGGCCTGGC
TGTTCAACATCGCCACCGCCGTGACCCTGCTGGCCGGCTCCGCGCTGGTCCTGCTGGACCGCAAGCTATGGCTCGGCGCC
GGGGCGCTGGCGGTGTTCCTGCTGCTGACCATCCTCATCGTCCACACCTTCTGGAGCAAGACCGGCGTCGAAGCCAAGCT
GGCGATGTTCTTCGCCCTCGAACACATCGCGGTGATCGGCGGCCTGATCGCCACGGCCATCGCCAGCGCGCAACGCCAGC
GGCTGCGCCAGGACGTCTCCGTGGCCGCCACCTACCAGAAGGCCTGAG