MEGAResFrom MEG, the Microbial Ecology Group

MEPB

The mepB gene encodes a protein thought to be involved with the mep efflux system, but this is unconfirmed.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>962|AY661734.1|AY661734|Multi-drug_resistance|Multi-drug_efflux_pumps|MEPB
ATGTGTAAATCTAAAATACTGTTGAAAAATATTTTTAGTGAAGAATCAGAAGTTAAAGATTTAACTGAAGAAAAATATAA
TCAAGATTACGAAGCATTAACATTTAGCTTTAAAGAGGAAACATATCAAAGTAGGTTAGCTAAGAAAACACCGACTAAAT
CGGGATATTTCGTGACATGTTGGACAAAAGACGAAGATAATTATAATCGGCCATACAAAATTGAAGAGTTTGCTGATTAC
CTGATTGTTGCTGTTATCGATGATGAATTAAATGGCTACTTTCTATTTCCTAGGGAATTATTGGTAGAAAAAGGTATCTT
AGCTTCATCTAAGTATCAAGGGAAAATGGCTTTTAGAGTTTATCCTAAGTGGTGTAATCAATTGAATAAAACAGCAGGGC
AAACACAAAAGTGGCAATGTAAATATTTTTTTGAATACTAA