MEGAResFrom MEG, the Microbial Ecology Group

MEPA

The mepA gene encodes a MATE system efflux pump under regulation of MepR.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|HE999704|947296-947620|ARO:3000026|mepA|Multi-drug_resistance|Multi-drug_efflux_pumps|MEPA
ATGAAACACTCAGATAATTATTATTTAACAAAAGCGAGCATTCCTAAAGCGATAGCGCACTTATCGATTCCAATGATGCT
CGGAATGTCGGTTGGGGTGATTTATAATATCGTCAATGCGTTCTTTATTGGTTTACTGCATGATACGTCGATGTTGACTG
CTGTAACACTCGGTTTACCAATGTTTACGATTTTAATGGCGATTGGGAATATGTTTGGTGTTGGCGGTGGGACGTATATT
TCTCGCTTGCTTGGGAAAGAGGAGGGAACCAAGGCAAAGCAAGTATCGGCCTTTGTGTTATACGGAAGTTTAGTGGCTTT
TTGAT

>Mdr|NC_002951.3236526|Multi-drug_resistance|Multi-drug_efflux_pumps|MEPA
ATGAAAGACGAACAATTATATTATTTTGAGAAATCGCCAGTATTTAAAGCGATGATGCATTTCTCATTGCCAATGATGAT
AGGGACTTTATTAAGCGTTATTTATGGCATATTAAATATTTACTTTATAGGATTTTTAGAAGATAGCCACATGATTTCTG
CTATCTCTCTAACACTGCCAGTATTTGCTATCTTAATGGGGTTAGGTAATTTATTTGGCGTTGGTGCAGGAACTTATATT
TCACGTTTATTAGGTGCGAAAGACTATAGTAAGAGTAAATTTGTAAGTAGTTTCTCTATTTATGGTGGTATTGCACTAGG
ACTTATCGTGATTTTAGTTACTTTACCATTCAGTGATCAAATCGCAGCAATTTTAGGGGCGAGAGGTGAAACGTTAGCTT
TAACAAGTAATTATTTGAAAGTAATGTTTTTAAGTGCACCTTTTGTAATTTTGTTCTTCATATTAGAACAATTTGCACGT
GCAATTGGGGCACCAATGGTTTCTATGATTGGTATGTTAGCTAGTGTAGGCTTAAATATTATTTTAGATCCAATTTTAAT
TTTTGGTTTTGATTTAAACGTTGTTGGTGCAGCTTTGGGTACTGCAATCAGTAATGTTGCTGCTGCTCTGTTCTTTATCA
TTTATTTTATGAAAAATAGTGACGTTGTGTCAGTTAATATTAAACTTGCGAAACCTAATAAAGAAATGCTTTCTGAAATC
TTTAAAATCGGTATTCCTGCATTTTTAATGAGTATCTTAATGGGATTCACAGGATTAGTTTTAAATTTATTTTTAGCACA
TTATGGAAACTTCGCGATTGCAAGTTATGGTATCTCATTTAGACTTGTGCAATTTCCAGAACTTATTATCATGGGATTAT
GTGAAGGTGTTGTACCACTAATTGCATATAACTTTATGGCAAATAAAGGCCGTATGAAAGACGTTATCAAAGCAGTTATC
ATGTCTATCGGCGTTATCTTTGTTGTATGTATGAGTGCTGTATTTACAATTGGACATCATATGGTCGGACTATTTACTAC
TGATCAAGCCATTGTTGAGATGGCGACATTTATTTTGAAAGTAACAATGGCATCATTATTATTAAATGGTATAGGTTTCT
TGTTTACTGGTATGCTTCAAGCGACTGGGCAAGGTCGTGGTGCTACAATTATGGCCATTTTACAAGGTGCAATTATCATT
CCAGTATTATTTATTATGAATGCTTTGTTTGGACTAACAGGTGTCATTTGGTCATTATTAATTGCTGAGTCACTTTGTGC
TTTAGCAGCAATGTTAATCGTCTATTTATTACGTGATCGTTTGACAGTTGATACATCTGAATTAATAGAAGGTTAA

>Mdr|AY661734.1|gene2|Multi-drug_resistance|Multi-drug_efflux_pumps|MEPA
AAGGAGTATTGAACAATGAAAGACGAACAATTATATTATTTTGAGAAATCGCCAGTATTTAAAGCGATGATGCATTTCTC
ATTGCCAATGATGATAGGGACTTTATTAAGCGTTATTTATGGCATATTAAATATTTACTTTATAGGATTTTTAGAAGATA
GCCACATGATTTCTGCTATCTCTCTAACACTGCCAGTATTTGCTATCTTAATGGGGTTAGGTAATTTATTTGGCGTTGGT
GCAGGAACTTATATTTCACGTTTATTAGGTGCGAAAGACTATAGTAAGAGTAAATTTGTAAGTAGTTTCTCTATTTATGG
TGGTATTGCACTAGGACTTATCGTGATTTTAGTTACTTTACCATTCAGTGATCAAATCGCAGCAATTTTAGGGGCGAGAG
GTGAAACGTTAGCTTTAACAAGTAATTATTTGAAAGTAATGTTTTTAAGTGCACCTTTTGTAATTTTGTTCTTCATATTA
GAACAATTTGCACGTGCAATTGGGGCACCAATGGTTTCTATGATTGGTATGTTAGCTAGTGTAGGCTTAAATATTATTTT
AGATCCAATTTTAATTTTTGGTTTTGATTTAAACGTTGTTGGTGCAGCTTTGGGTACTGCAATCAGTAATGTTGCTGCTG
CTCTGTTCTTTATCATTTATTTTATGAAAAATAGTGACGTTGTGTCAGTTAATATTAAACTTGCGAAACCTAATAAAGAA
ATGCTTTCTGAAATCTTTAAAATCGGTATTCCTGCATTTTTAATGAGTATCTTAATGGGATTCACAGGATTAGTTTTAAA
TTTATTTTTAGCACATTATGGAAACTTCGCGATTGCAAGTTATGGTATCTCATTTAGACTTGTGCAATTTCCAGAACTTA
TTATCATGGGATTATGTGAAGGTGTTGTACCACTAATTGCATATAACTTTATGGCAAATAAAGGCCGTATGAAAGACGTT
ATCAAAGCAGTTATCATGTCTATCGGCGTTATCTTTGTTGTATGTATGAGTGCTGTATTTACAATTGGACATCATATGGT
CGGACTATTTACTACTGATCAAGCCATTGTTGAGATGGCGACATTTATTTTGAAAGTAACAATGGCATCATTATTATTAA
ATGGTATAGGTTTCTTGTTTACTGGTATGCTTCAAGCGACTGGGCAAGGTCGTGGTGCTACAATTATGGCCATTTTACAA
GGTGCAATTATCATTCCAGTATTATTTATTATGAATGCTTTGTTTGGACTAACAGGTGTCATTTGGTCATTATTAATTGC
TGAGTCACTTTGTGCTTTAGCAGCAATGTTAATCGTCTATTTATTACGTGATCGTTTGACAGTTGATACATCTGAATTAA
TAGAAGGTTAA