MEGAResFrom MEG, the Microbial Ecology Group

MDTO

The mdtO gene encodes a multi-drug efflux pump in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|AP009048|4304505-4306557|ARO:3003549|mdtO|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTO
TCATTGCGTGGCTCCTTGTGCCTGTTCCGTGGCGGGCGTTAATGCCGGGGCTGTCCAGTCTGGCAAGCGGGCGAAAAGCT
GGCAGACGTGTTGCTCCTGTTTTAATAAGGTGGGCAGGATGGCCTGAGAGGCGGGTGTCTCTTCAAGCGTTATTTGAGGA
GAACGGCTGAGTGCGGTTGCCAGACCGGCAGCGTATTTCTCCAGGGCGTCGGCAAACTGACCTGCTCTGTCCGGCTGTAG
TGCGTTATCCAGCGCCTGCGCCGAGTTCCAGGTGGCATCCCAGGCGTGAAGAAGATCGCGGCCCTGACGAATAACCGTTT
GCGAACGTTCAATCAGTAATGCGCGTTCTTCGCTGTCCAGTTGACGCTCCAGCGCCACGCGTTGGCACATCTCTTCACAG
GCATTAAACGCCGCATGCAGACCGATACGAATTTGCAGATAAGTGCGCAGAGCCGTGACTTCCTGCTGGCGTGGGATCCG
CATTACTTTACTTAACATACCCAGCGTGCCAGCCAGTTTTTGCGGCAGTGTGCGCGCTTCACTTTCAGGCCAGACAAAGG
TGTAAATCACCGCGGACACCACGGTACCAATGATGATACCCAGGGCGCGATCGCGAATTTCCACCAGGTCGTACACTGGG
CCAAAAACGTTTTCGAGCGTGGCGAGCGCGAAGGTGACCACCATCTGTGTGCCGATATAAGAAGAGCGTTCAGAGCTGGT
GGCAATCCATGCGCCCAACAGGAAAATCGGTGCCAGCACAAACAGCAATTCGACAATATTGTCCAGCCAGGGCATGACCA
GTAGCGTGAATAACAGCGCCAGAATCGCGCCGCAAAAGGCCCCGCCAAAACGCAGCACCATCTTCTGGTACGACGAACCG
ACATTTGGGTTAGCGACGATCACGCATGTCAGCATACAGGTGTGAATGCCTTCCCAGTCCACGCCGCTGTAAAAGGTGTA
ACAGATCAAACAGGCGAGCAGCGTTTTTACCGCGTAGCGCATATAGTCTGGATTGGTAAAAGCATCGGCGGCCATTGATG
GCGGTTTGGCTGCGGGCGTTGGCGGCGTATTCGGGTCCATCTGACCCAGTTGTAACAACGTCTGGCAGATATTCTCCAGG
TTACATTCCCGTGCCGCCATCGCTTCACTTTCACTGATCCGCCAGTCGCTTTGCCAGCACTGACCTTCAGCAACGGCATG
CTGCAGCTTGTTGATTTCTGAAGCTAATTTTTGTCGGAATTCAATAATTGCCTGAGAATCAGCAAAAGAGGTGGGATCGT
AGCGATTCAGCGTCGAGTAAATGTAGGTTACCGTTGCCACGCAGCTTTGCCACCATGCGTTTTGAGTTCGCCAGTTGGCA
TCGTCCGCGAGGCAAAAGACATTGAGTTTTTGTAGCGCCAGCGCCTCTCTTTCAATCCGCGTTTCGGGTAGCGGTGCGAG
GCTGTCTGTCAGGTGACTAATGGCATCATCAAGCCGATCATTAAGCGCCTGATGCATTTGCGAAATGGCACGACTGGGAA
ACCACAGCACGCCGATTAACGTCATCAGCAAGGTTGGATAGAGGCCAACAACGATACACCACAGCGTTAAGCGCACGACC
ACTTCCGGATAGTCGAGCATGGCGGGGAAGGTTTGCCCGTAAATAGCGACAATGGCGACGGCGAAAAAGACCAGCCCCAA
GCGATGGGTGCGCATCAAAAACATGCAGCCCATCAGGATCGGTCCGGCGATGATCAATCGGATCAACGGTTCGCCGTATG
ACCATTTGTAGATCAAAAACAGGCTGCCGATCTCCAGCACCGTGGCAACCACAAACAAGATCGCGACAAATTTGGTGTAA
AACGCGTTCGACTGAATACCGTAAAACAGCACTGCCAGCGATAACGCCACAAAAGGGATCTCAAAGGTCATCGAGATCAG
AATCACCAGCAGGCAGCCTACCCAGAGTTGCACGGTCTGCGGCACGCGACCTGGTCGCCGCTCGCTTAACTCTTCATGAA
AGAACGCCAGCAGCCTGACCACCGGTAATGGCAGGGAGTTGAGCGCGCTCAT