MEGAResFrom MEG, the Microbial Ecology Group

MDTN

The mdtN gene encodes a multi-drug efflux pump in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|AP009048|4306556-4307588|ARO:3003548|mdtN|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTN
TTATTGCGGCTCAAGATTAGCGACTGCCGAAGCGCCGATGCGGAACATTTCCGGGTCAGGTTTATCGACCATGATTTTGA
CCGGAAAACGCTGGGCAACGCGGACCCAGTTAATAGAACGAGACACTTTCGGCAGGCCGCCCAGCACCAGGCCGCCGTCA
TCCGGTAGCACGCCGTAGCCAATCGAATCCACTTTACCCTCGAAGGTTTTGCCGCTGTCACTCATCAGGCGAATCGTTGC
GGGTGTACCTGAGCGAATATTTTTCAGATCGGTTTCGCGGAAGTTGGCGATCACATACCAGTGACGAGTGTCGATTAGGG
TAAAAATAGGGCGCATGGCAGAAGCAAATTGCCCGACGGAGGTTTTGAGGGAAATGACCCGGCCATCAAACGGCGCGCGA
ACGGTCGCCATTTCCAGATGCAGTTTGGTCAGGGCAATATCCGCTTCGACCGCCGCACGCTGGGCAACTAATGCATCCAC
GCCGCTGACGGCGCTGGCGGCTGACTGCGCCTGTAACAATACGGCATTAAGATCCGCTTCTGCGGCGCGCTGCGCCGTTC
TTGCACGGTCAACATCTTCCGCTGAGACAAAACCTTCTTTCAGTAATGGCTCGGTGCGGCGTAATGTATCTGTGGCCTGT
TTCGCGGCGGCACGGGCTTTTTCTACCGTGGCATTAACCGAGTCGGCACCAAACTGTTGCGCGTCAACGCTACGCTGGGT
GAGCATAATTTGCTTATCCAGCGCCGCGAGGGAGGCTTCAGCTTTCGCCAGATTGGCTTCGTACGGGCGCGGGTCGATGC
GGAACAGCAAATCGCCCTGTTTGACTGCCTGGTTGTCGGTGACCGCCAGTTCTACAATGCGGCCGCTGACTTCCGGTACC
ACATCAATGGTATCTGCTGACGCGTAAGCGTCATTAGTTGATGGCGCACTGTCTACGCGCCAGATAACGAAAACAAGGGC
AACCAGCGCCAACGCAACCACTAACAGAGCAGGGAATTTACTGCGAGGAGCTTTTTTCGGCGTACTTTCCAT