MEGAResFrom MEG, the Microbial Ecology Group

MDTL

The mdtL gene encodes a putative major facilitator superfamily efflux pump in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>Mdr|AP009048.1|gene3616|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTL
ATGTCCCGCTTTTTGATTTGTAGTTTTGCCCTGGTTTTACTTTATCCCGCCGGGATTGATATGTACCTCGTTGGTTTACC
GCGCATCGCCGCCGATCTCAATGCCAGCGAAGCGCAGTTGCATATTGCGTTCTCCGTATATCTGGCGGGGATGGCAGCTG
CGATGTTATTTGCCGGTAAAGTGGCCGATCGTTCAGGGAGAAAGCCGGTCGCCATACCCGGCGCGGCGCTATTTATTATT
GCCTCGGTGTTCTGTTCACTGGCTGAAACCAGCACGTTATTTCTTGCAGGCCGATTTCTACAGGGGTTGGGCGCAGGCTG
TTGTTACGTAGTGGCGTTCGCTATTTTGCGCGACACGCTGGATGATCGACGTCGGGCTAAAGTGCTGTCATTACTCAACG
GTATTACCTGCATCATTCCGGTGTTAGCGCCAGTGCTCGGACATCTGATTATGCTTAAATTCCCGTGGCAGAGTCTGTTC
TGGGCGATGGCAATGATGGGCATCGCGGTACTGATGTTGTCTTTGTTTATTTTAAAAGAAACGCGCCCAGCGGCCCCCGC
AGCTTCGGATAAACCACGAGAAAATAGCGAGTCGCTGCTTAACCGTTTTTTCCTCAGCCGTGTTGTTATCACCACCCTCA
GCGTTTCGGTGATCCTCACTTTCGTCAACACGTCACCGGTATTGCTGATGGAAATCATGGGGTTTGAGCGCGGTGAATAC
GCCACCATTATGGCGCTGACCGCTGGCGTCAGCATGACCGTTTCATTCTCCACGCCATTTGCGCTGGGAATTTTTAAGCC
ACGTACGTTGATGATCACCTCGCAGGTGTTATTCCTGGCGGCGGGGATCACTCTTGCCGTTTCACCTTCCCATGCGGTTT
CTCTGTTTGGTATCACGCTGATTTGCGCCGGTTTCTCGGTAGGTTTTGGTGTGGCGATGAGTCAGGCGTTAGGGCCGTTT
TCATTACGCGCGGGCGTAGCCAGCTCGACCTTAGGTATTGCGCAGGTTTGCGGTTCGTCACTGTGGATTTGGCTGGCAGC
GGTGGTTGGTATCGGCGCATGGAATATGCTGATCGGGATTCTGATTGCCTGTAGCATAGTGAGCCTGTTGCTGATTATGT
TCGTCGCGCCTGGACGCCCCGTTGCCGCTCATGAAGAAATCCATCACCACGCTTGA