MEGAResFrom MEG, the Microbial Ecology Group

MDTK

The mdtK gene encodes a multi-drug efflux pump in Salmonella enterica.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|NC_007779|1745170-1746544|ARO:3001327|mdtK|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTK
GTGCAGAAGTATATCAGTGAAGCGCGTCTGTTATTAGCATTAGCAATCCCGGTGATTCTCGCGCAAATCGCCCAAACTGC
GATGGGTTTTGTCGATACCGTGATGGCGGGCGGCTATAGTGCCACCGACATGGCGGCGGTCGCTATCGGTACTTCTATCT
GGCTTCCGGCGATCCTCTTTGGTCACGGACTGCTGCTGGCATTAACGCCGGTTATCGCGCAATTAAATGGTTCCGGTCGA
CGTGAGCGCATTGCGCATCAGGTGCGACAAGGTTTCTGGCTGGCAGGTTTTGTTTCCGTTCTCATTATGCTGGTGCTGTG
GAATGCAGGTTACATTATCCGCTCCATGGAAAACATCGATCCGGCTCTGGCGGACAAAGCCGTGGGTTATCTGCGTGCGT
TGTTGTGGGGCGCGCCGGGATATCTGTTCTTCCAGGTTGCCCGTAACCAGTGTGAAGGTCTGGCAAAAACCAAGCCGGGT
ATGGTAATGGGCTTTATCGGCCTGCTGGTGAACATCCCGGTGAACTATATCTTTATTTATGGTCATTTCGGTATGCCTGA
GCTCGGTGGCGTTGGTTGTGGCGTGGCTACTGCGGCGGTGTATTGGGTCATGTTCCTTGCCATGGTTTCTTACATTAAAC
GCGCCCGCTCCATGCGCGATATTCGTAACGAAAAAGGCACCGCAAAACCCGATCCTGCGGTTATGAAACGACTGATTCAA
CTCGGTTTGCCGATTGCGCTGGCACTGTTCTTTGAAGTGACACTGTTTGCCGTCGTGGCTCTGTTAGTGTCTCCGCTCGG
TATTGTTGATGTCGCAGGACACCAGATTGCCCTGAACTTTAGTTCACTAATGTTCGTGCTTCCAATGTCGCTGGCGGCAG
CGGTAACTATCCGCGTAGGTTATCGTCTGGGTCAGGGCTCAACGCTGGATGCGCAAACCGCTGCGCGGACCGGGCTTATG
GTGGGTGTCTGTATGGCAACCCTGACGGCCATTTTCACGGTTTCACTGCGGGAGCAAATCGCCCTGTTGTACAACGACAA
TCCCGAGGTTGTAACGCTGGCTGCGCATTTGATGTTGCTGGCGGCGGTATATCAGATTTCTGACTCAATCCAGGTGATTG
GCAGTGGGATTTTGCGTGGTTATAAAGATACGCGTTCCATTTTCTATATTACCTTTACGGCTTACTGGGTGCTGGGCTTG
CCAAGCGGCTATATTCTGGCACTGACCGATCTGGTCGTTGAACCTATGGGGCCAGCAGGCTTCTGGATAGGCTTTATTAT
TGGCCTGACGTCGGCAGCCATTATGATGATGTTGCGTATGCGGTTCCTGCAACGTCTGCCGTCAGCCATCATTCTGCAAC
GAGCATCCCGCTAAT