MEGAResFrom MEG, the Microbial Ecology Group

MDTH

The mdtH gene encodes a putative multi-drug efflux system in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|U00096|1124117-1125326|ARO:3001216|mdtH|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTH
TCAGGCGTCGCGTTCAAGCAAACGACGCGCGGCGCGTTTCTGGCTAAACTGCCAACCCAGCGCAAGGAAAGTGAAGATGC
CAATAATGCCCAGCATCATCCACGGAAGCTCTGGCTGGTGCGCCGATTTGCCCAGGTCAAACAGCCAGCCGCCACCGATA
TAACCAATAGCGCCGCCAATCGCCAGACCCAGACGGCTAAACCCCATATAGCTGCCGCGAGCTCTTGCGTCCGCCAGCGA
AGCACTTAAGGTTTCACGCGCAGGCTCGGCAATGATCGACCCGATATAAAACAGACAAATCAGGGTGAAAAGTTGTTGCA
GGCCGCTGACCATGCCCACCGGCATCATGCTTAATGACATTATCAACAGCCCAGCCATCAACCGGTGTTCCAGACGAAAA
TGCTTTTCACTCCAGCGGGCGATAGGGTAGAGCAACGTTAACGACAGACACGCTTCAATGGCATACATCCATTTAACGGC
AGAGGGCGCGCCAGCCACGTCGTTGACCATAATTGGCAGCATCAGCATCACTTGTACAGCCAGCATGTAGTAACCCGCCA
GCGTCAGAACATAGGTGACAAAACGCTTGTCACGCATCACGCGGGTCATGCCTTCGCGAACGGGCGTGCGTACGGTGGAG
AGTTTCCATGCTGGTAACAACCACGCATTGAACGCCGCACATAGCACAAATAGAACTGCCCCTGTGGCGCAGACCAGGCG
AAAGTCGTATTGCAACAGCCAGCTCCCCAACAATGCGCCAATGACCGCACCGGCACTGTCCTGCATCATCAACAGCGAGA
AAAAACGACCACGCTGCTGTGGACGGATTAATTTCACCACCAGCGCCGAACGCGGCGGATCAAACAACGTGCCACCGAGT
CCCGAGAGCAGGCATGAAAACCACAATAGCCACGGTTCGTGGGCGATACCCATTGTGGCGAATCCGGCGGCGCGCATCAG
CATACCGGTAACAATCATCGGTTTGGCACCAAAGCGGTCGGCAATTGCACCGCCGAAAATACCCAGACCTTGCTGAATAA
ATTGGCGTAGACCGAGAGCAATACCGACCATGACGGCGGCCCAGCCCATTTGATCAACGAAGCGGATAGAGATCAGCGGG
AAGACAACAAAGAACCCCAGCACGACCAGCATATTATCGATGAGCAGGAAATATTTACCCAGGTTCCTCGCCTGCGACAC
GCGGGACATT