MEGAResFrom MEG, the Microbial Ecology Group

MDTG

Also known at yceE, the mdtG gene encodes a putative efflux pump in Escherichia coli that is overexpressed in resistant strains.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|NC_007779|1115840-1117067|ARO:3001329|mdtG|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTG
TCAGTTCGATACCTGGGGTATTCGACGACGACGTAGACTGTTCCATGAATAGACTGCGTTGAATAACACTACGCCAGCGG
TGACGAGAAATACCGCTCTGAAACCGTAGTTCGCTGAAATCGCTGCTCCCATCAATGGTCCGGTAACGTTGCCAATATCA
CGAAACGATTGGTTATAGCTGAAGATACGCCCGGCGATCTGGTTGCTCGAGTTGTAAACCAACAGTGTCTGTACGGCGGG
GAGTAGTGCACCATCGGCGGCACCGAGCAAAAAACGTAAAATCCCAAGTTGCAATGGCGTCTGAACGTAAGACATTGGGA
TCAACAGCAGTACAGAAAAGATCAGCGCTGTAATCAGGATCTTTTCGGGTCCGATTCGATCGCCAAGTTTGCCGAGTCGT
GGTGCACTTAGCAGAGCCGCCACGCCTGGCACCGAGGCGATCATGCCACTGATAAAGGCGACGTTACTGACGTTACCCGC
CAGTTCGCGGACATACAGCGTCAGAATGGGGGCAATTGAGCCCGTCGCCACCTGGATGATTAACGTAGTGACAAACAGGC
TGAGTACCAGTTTCGGGTTTTTAAGTGATGTCACCACTTCCCGCATGTGCAGCATCTCTTTTTTGCTGACCGGCTGGAAT
TTTTCTCTGATGCAAAACAGGGTGACGAAAAAGCAGAGTATGAGCACACTGGCGGTAATAAAGAATACCGGACGTAAGCC
GTAGCTATCGGCGAGCAGGCCGCCAGCCATTGGGCCGAGCAACGCACCACTAACGCCGCCTGTGGAGAGCGTACCCAGCG
CCCAGCCGCTTTTATTACGCGGTACTTGTGTGGCGATAAGAGCATTAGCGTTGGGGACAAATCCGCCAAGTAACCCAAGA
AGCGCCCGCAGGATCAAAAACTGCCAGATATTTTGTGCCAGCCCCATCAACACCATCACGATGCCCATGCCGAGGGCAGA
GCGTAATAGCATGAGTTTTCGGCCTTTACGGTCGGCGAGTCCACCCCAAAACGGTGAGGCGATGGCCGAAAATAAAAATG
TAATGCTGAAGACAATACCGGACCACATATTCAGGGCGGAGTGACCGGTAACGCCAAGCTGCTCAACGTAGAGGGGTAAG
AAGGGCATTACCAGACTGAAGGCGGCACCGGTAAGAAAACAGCCTAGCCAGGCGACGATCAGGTTTCGTTTCCAGTTTAT
AGGGGTGTCATTTTCACAGGGTGACATA