MEGAResFrom MEG, the Microbial Ecology Group

MDTD

The mdtD gene encodes a putative multi-drug efflux pump in Salmonella enterica.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>Mdr|AP009048.1|gene2135|Multi-drug_resistance|Multi-drug_efflux_pumps|MDTD
ATGACAGATCTTCCCGACAGCACCCGTTGGCAATTGTGGATTGTGGCTTTCGGCTTCTTTATGCAGTCGCTGGACACCAC
CATCGTAAACACCGCCCTTCCCTCAATGGCGCAAAGCCTCGGGGAAAGTCCGTTGCATATGCACATGGTCATTGTCTCTT
ATGTGCTGACCGTGGCGGTGATGCTGCCCGCCAGCGGCTGGCTGGCGGACAAAGTCGGCGTGCGCAATATTTTCTTTACC
GCCATCGTGCTGTTTACTCTCGGTTCACTGTTTTGCGCGCTTTCCGGCACGCTGAACGAACTGTTGCTGGCACGCGCGTT
ACAGGGCGTTGGCGGCGCGATGATGGTGCCGGTCGGCAGATTGACGGTGATGAAAATCGTACCGCGCGAGCAATATATGG
CGGCGATGACCTTTGTCACGTTACCCGGTCAGGTCGGTCCGCTGCTCGGTCCGGCGCTCGGCGGTCTGCTGGTGGAGTAC
GCATCGTGGCACTGGATCTTTTTGATCAACATTCCGGTGGGGATTATCGGTGCGATCGCCACATTGCTGTTAATGCCGAA
CTACACCATGCAGACGCGGCGCTTTGATCTCTCCGGATTTTTATTGCTGGCGGTTGGCATGGCGGTATTAACCCTGGCGC
TGGACGGCAGTAAAGGTACAGGTTTATCGCCGCTGACGATTGCAGGCCTGGTCGCAGTTGGCGTGGTGGCACTGGTGCTT
TATCTGCTGCACGCCAGAAATAACAACCGTGCCCTGTTCAGTCTGAAACTGTTCCGTACTCGTACCTTTTCGCTGGGCCT
GGCGGGGAGCTTTGCCGGACGTATTGGCAGTGGCATGTTGCCCTTTATGACACCGGTTTTCCTGCAAATTGGCCTCGGTT
TCTCGCCGTTTCATGCCGGACTGATGATGATCCCGATGGTGCTTGGCAGCATGGGAATGAAGCGAATTGTGGTACAGGTG
GTGAATCGCTTTGGTTATCGTCGGGTACTGGTAGCGACCACGCTGGGTCTGTCGCTGGTCACCCTGTTGTTTATGACTAC
CGCCCTGCTGGGCTGGTACTACGTTTTGCCGTTCGTCCTGTTTTTACAAGGGATGGTCAACTCGACGCGTTTCTCCTCCA
TGAACACCCTGACGCTGAAAGATCTCCCGGACAATCTGGCGAGCAGCGGCAACAGCCTGCTGTCGATGATTATGCAATTG
TCGATGAGTATCGGCGTCACTATCGCCGGGCTGTTGCTGGGACTTTTTGGTTCACAGCATGTCAGCGTCGACAGCGGCAC
CACACAAACCGTCTTTATGTACACCTGGCTTAGCATGGCGTTGATCATCGCCCTTCCGGCGTTCATCTTTGCCAGAGTGC
CGAACGATACGCATCAAAATGTAGCTATTTCGCGGCGAAAAAGGAGCGCGCAATGA