MEGAResFrom MEG, the Microbial Ecology Group

MDFA

The mdfA gene encodes a putative membrane protein that is part of a major facilitator superfamily efflux system in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>222|JQ394987.1|JQ394987|Multi-drug_resistance|Multi-drug_efflux_pumps|MDFA
ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTTCCTCTCTGTCTGGTGCTTTACGAATT
TTCAACCTATATCGGCAACGATATGAGGCAACCCGGTATGTTGGAAAATGTGGAACAATATCAGGCGGGCATTGAGTGGG
TTCCTACTTCGATGAACGCGTATCTGGCGGGCGGGATGTTTATACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGT
CGTCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACATGTCTGGCAATATTGCTGGCGCAAAACATTGAACA
ATTCACCCTGTTGCGCTTCTTGCACGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGACGCAATTCAGGAATCCT
TCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
GGCGCGTCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGG
TCTGCAACGGGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC
TGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCCTTAGTCTGCCGTTGCTGGCGTGGATCGCC
CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGC
GTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGC
CGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGGTTA
AGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGTTATGAGTAAAGG
TACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGA
ACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTTGCTGTCGCTGATGGTTATCTTTTTAAAA
GATAAACAGATGGGAAATTCTCACGAAGGGTAA