MEGAResFrom MEG, the Microbial Ecology Group

EMRE

The emrE gene encodes a multi-drug efflux pump in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|NC_002516.2|5606102-5606435|ARO:3000264|emrE|Multi-drug_resistance|Multi-drug_efflux_pumps|EMRE
ATGACCAACTATCTCTACCTCGCCATCGCCATCGCCGCCGAAGTGGTCGCCACCACCTCGCTGAAAGCCGTCGCCGGATT
CAGCAAGCCACTGCCGCTGCTGCTGGTGGTGGGCGGCTACGTGCTCGCCTTCAGCATGCTCGTGCTGGTCATGCGCACCC
TGCCGGTCGGCGTGGTCTACGCCATCTGGTCCGGACTCGGCATCGTCCTGGTCAGCCTGGTGGCGATGTTCGTCTACGGC
CAGCGCCTGGACCCCGCCGCCCTCCTCGGCATCGGCCTGATCATCGCCGGCGTGCTGGTGATCCAGTTGTTCTCCCGCGC
TTCGGGGCACTGA

>CARD|phgb|NC_007779|567537-567870|ARO:3000264|emrE|Multi-drug_resistance|Multi-drug_efflux_pumps|EMRE
ATGAACCCTTATATTTATCTTGGTGGTGCAATACTTGCAGAGGTCATTGGTACAACCTTAATGAAGTTTTCAGAAGGTTT
TACACGGTTATGGCCATCTGTTGGTACAATTATTTGTTATTGTGCATCATTCTGGTTATTAGCTCAGACGCTGGCTTATA
TTCCTACAGGGATTGCTTATGCTATCTGGTCAGGAGTCGGTATTGTCCTGATTAGCTTACTGTCATGGGGATTTTTCGGC
CAACGGCTGGACCTGCCAGCCATTATAGGCATGATGTTGATTTGTGCCGGTGTGTTGATTATTAATTTATTGTCACGAAG
CACACCACATTAAA