MEGAResFrom MEG, the Microbial Ecology Group

EMRD

The emrD gene encodes a multi-drug efflux pump in Escherichia coli.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>252|FJ744595.1|FJ744595|Multi-drug_resistance|Multi-drug_efflux_pumps|EMRD
ATGAAACGGCATAAGAACTTCAATTTGTTGTTGATGCTGGTACTGCTGGTGGCCGTCGGCCAGATGGCGCAGACCATTTA
TATTCCGGCCATCGCCGACATGGCGGTCGCGCTGAACGTCCGCGAAGGGGCGGTACAAAGCGTGATGGCGGCCTACCTGC
TGACCTACGGTATTTCACAGCTATTCTACGGCCCGCTCTCTGACCGCGTCGGTCGCCGCCCGGTGATCCTCGTCGGGATG
TCGATTTTTATGCTGGCGACGCTGGTAGCTATTACCACCCATAGCCTGCCGGTGCTGATCGCCTCCAGCGCCATGCAGGG
GATGGGCACCGGGGTCGGCGGCGTGATGGCGCGTACCCTGCCCCGCGACCTGTACGAAGGCGCTCAGCTGCGTCATGCCA
ATAGCCTGTTAAATATGGGTATTCTGGTCAGCCCGCTGATTGCCCCGCTGCTCGGCGGCATCCTCGACACCCTGTGGAGC
TGGCGCGCCTGCTACGCTTTCCTGCTGGTCCTGTGCGCCGGGGTGACCTTCAGCATGGCGAAGTGGATGCCGGAAACGCG
CCCGGAAGGGGCGCCGCGCACCAAACTTCCGGCCAGCTACAAAACGCTGTTCGGCACCGGCGCCTTTAACTGCTATCTGC
TGATGCTGATCGGCGGCCTGGCGGGGATTGCGGTATTCGAAGCCTGCTCCGGGGTGCTGATGGGCGCGGTGCTCGGCCTG
AGCAGCATGGCGGTGAGTATTCTGTTTATTCTGCCGATCCCGGCGGCGTTCTTCGGGGCGTGGTTTGCCGGCCGGCCGAA
CAAGCGTTTCCCGACCCTGATGTGGCAGTCGGTGATCTGCTGCCTGCTGGCGGGTCTGATGATGTGGATCCCAGGGCTGC
TGGGCATCATGACCGTCTGGACCCTGCTGGTGCCTGCGGCGCTGTTCTTCTTCGGCGCCGGGATGTTGTTCCCGCTGGCC
ACCAGCGGCGCGATGGAGCCGTTCCCGTTCCTCGCCGGAACCGCCGGGGCGCTGGTGGGCGGCTTGCAGAATATCGGCTC
CGGCGTGCTGGCCTGGCTGTCGGCGATGATGCCGCAAACCGGTCAGGGCAGCCTCGGCCTGCTGATGATGCTGATGGGCC
TGTTGATTCTGCTGTGCTGGCTGCCGCTGGCCTCGCGCTTCACCCACCATCAGCAGCCGGTATAA