MEGAResFrom MEG, the Microbial Ecology Group

EMEA

The emeA gene encodes a norA homolog multi-drug efflux pump in Entercoccus faecalis.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|AB091338|173-1355|ARO:3003551|emeA|Multi-drug_resistance|Multi-drug_efflux_pumps|EMEA
ATGACGAAAAAAAATAGTATGATGTACTTAGCAATTTCTAACTTATTTCTTGTTTTTCTAGGCGTAGGCCTAGTCATTCC
CGTAATTCCCCAATTAAAAGAAGAAATGCATTTTTCTGGTACCACAATGGGAATGATGATTTCTATTTTTGCGATTGCCC
AATTAATCACATCGCCAATCGCAGGTGTCCTTTCGGATAAAATTGGTCGGAAAAAAATGATTGCGACGGGCATGTTGGTG
TTTTCAATTTCTGAGTTATTATTTGGTTTAGCCCAAGCGAAAAGCGGTTTTTATATTTCTCGTGGTTTAGGTGGGATTGC
CGCCGCGTTATTAATGCCGTCAGTGACAGCCTTTGTGGCAGATATGACCACGATTTCTGAACGTCCGAAAGCGATGGGGC
TTGTGTCAGCTGCAATTAGTGGTGGTTTTATTATCGGACCAGGAGTTGGTGGTTTTATTATCGGACCAGGAGTTGGTGGT
TTTATTGCTTATTTAGGAATTCGCGCTCCATTTTTTGCGGCCGCATTTTTAGCGTTTATTGGTTTTATTTTGACATTAAC
TGTTTTGAAGGAGCCAGAGAAACGAATTTTAGCCGCTGTTGAAGCGAAAAAAGGTTCATTTATGGATATTTTAAGAAATC
CAATGTTTACCTCATTATTTGTGATTATCTTAATTTCCTCTTTTGGCCTGCAAGCGTTCGAATCTATTTATAGTATTATG
GCGACCATTAATTTTGGCTTTACCACAAGTGAAATAGCAATCGTGATTACGGTTAGTGGTATTTTAGCGTTGATTTGTCA
GCTGTTTTTCTTTGATGCAATCGTCCAAAAAATAGGTGAAATGGGTTTAATCCAATTAACCTTTTTTGCAAGTGCCATTT
TTATTGCCGTGATTGCCTTTACAAAAAATAATTTAGTTGTTGTATTTTCAACGTTTATTGTCTTTTTAGCGTTTGACTTG
TTTAGACCAGCAGTAACTACTTATTTATCCAAACATGCTGGAGATCAACAAGGAACCATCAACGGACTAAATTCGACATT
TACAAGTTTTGGTAATATTTTAGGACCAATGGCAGCAGGAGCTTTATTTGATATCAATCACTTTTTCCCTTATTATGTTT
CAGCAGTAATTCTGTTAGGAACGGGCTTTTTATCGTTATTTTTAAATCGAAATAAGATGTAA