MEGAResFrom MEG, the Microbial Ecology Group

BLT

The blt gene encodes a multi-drug efflux system under regulation of BltR.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>Mdr|AL009126.3|gene1906|Multi-drug_resistance|Multi-drug_efflux_pumps|BLT
ATGAAAAAATCAATAAATGAGCAAAAAACGATATTCATTATACTATTAAGCAACATCTTCGTAGCATTTCTTGGTATCGG
TTTAATCATTCCAGTTATGCCTTCTTTTATGAAAATCATGCATTTATCCGGCAGCACAATGGGTTATCTTGTTGCGGCTT
TTGCCATTTCTCAGTTAATTACTTCACCTTTTGCAGGTAGGTGGGTTGACCGTTTCGGGAGAAAAAAAATGATTATTCTC
GGGTTGCTTATATTCAGTTTATCTGAGTTGATTTTCGGATTAGGGACCCATGTTTCAATATTTTATTTCTCGAGGATATT
GGGTGGTGTAAGTGCGGCTTTTATCATGCCCGCGGTAACAGCATATGTAGCTGATATTACAACCCTAAAGGAAAGGTCAA
AGGCTATGGGGTATGTTTCTGCTGCAATTAGCACCGGCTTTATTATTGGACCTGGTGCGGGAGGATTTATTGCCGGCTTT
GGTATCCGCATGCCGTTTTTCTTCGCCTCCGCCATCGCGTTAATAGCAGCTGTCACTTCCGTTTTTATACTAAAAGAGTC
ATTGTCGATAGAAGAACGCCATCAACTCTCATCTCATACAAAGGAATCAAATTTCATTAAAGACTTGAAGAGATCCATTC
ATCCTGTCTATTTCATTGCATTTATTATCGTCTTTGTAATGGCTTTTGGTTTATCAGCTTATGAAACGGTATTCAGCTTG
TTTTCTGATCATAAATTTGGCTTCACACCAAAAGATATTGCAGCCATTATTACGATTAGTTCCATTGTTGCGGTAGTTAT
TCAAGTTTTACTATTCGGGAAATTGGTCAACAAACTTGGAGAGAAAAGAATGATTCAGCTGTGCTTAATAACCGGTGCGA
TCTTGGCTTTCGTGTCTACTGTTATGTCAGGATTTTTAACTGTTTTGCTTGTAACTTGTTTTATTTTTCTGGCGTTCGAT
TTGCTACGTCCGGCCTTAACCGCTCATTTATCCAATATGGCCGGTAACCAGCAGGGTTTCGTAGCAGGCATGAACTCCAC
ATACACCAGCCTGGGAAATATATTTGGACCTGCTCTAGGCGGTATACTATTTGATCTTAACATTCATTATCCTTTCCTTT
TTGCAGGTTTCGTTATGATTGTCGGCCTTGGTCTTACAATGGTTTGGAAAGAAAAAAAGAATGATGCTGCAGCTTTGAAT
TAA

>Mdr|L32599.1|gene2|Multi-drug_resistance|Multi-drug_efflux_pumps|BLT
TTGACTATACGGTAACCATATACCTTATGATTTGATTGTACTTGAAAAAAGCTTCAAGCGAAAAGGATAGGTAAAAAGGG
TTCAATTGAGTAAAAGGGGAATTCAGATGAAAAAATCAATAAATGAGCAAAAAACGATATTCATTATACTATTAAGCAAC
ATCTTCGTAGCATTTCTTGGTATCGGTTTAATCATTCCAGTTATGCCTTCTTTTATGAAAATCATGCATTTATCCGGCAG
CACAATGGGTTATCTTGTTGCGGCTTTTGCCATTTCTCAGTTAATTACTTCACCTTTTGCAGGTAGGTGGGTTGACCGTT
TCGGGAGAAAAAAAATGATTATTCTCGGGTTGCTTATATTCAGTTTATCTGAGTTGATTTTCGGATTAGGGACCCATGTT
TCAATATTTTATTTCTCGAGGATATTGGGTGGTGTAAGTGCGGCTTTTATCATGCCCGCGGTAACAGCATATGTAGCTGA
TATTACAACCCTAAAGGAAAGGTCAAAGGCTATGGGGTATGTTTCTGCTGCAATTAGCACCGGCTTTATTATTGGACCTG
GTGCGGGAGGATTTATTGCCGGCTTTGGTATCCGCATGCCGTTTTTCTTCGCCTCCGCCATCGCGTTAATAGCAGCTGTC
ACTTCCGTTTTTATACTAAAAGAGTCATTGTCGATAGAAGAACGCCATCAACTCTCATCTCATACAAAGGAATCAAATTT
CATTAAAGACTTGAAGAGATCCATTCATCCTGTCTATTTCATTGCATTTATTATCGTCTTTGTAATGGCTTTTGGTTTAT
CAGCTTATGAAACGGTATTCAGCTTGTTTTCTGATCATAAATTTGGCTTCACACCAAAAGATATTGCAGCCATTATTACG
ATTAGTTCCATTGTTGCGGTAGTTATTCAAGTTTTACTATTCGGGAAATTGGTCAACAAACTTGGAGAGAAAAGAATGAT
TCAGCTGTGCTTAATAACCGGTGCGATCTTGGCTTTCGTGTCTACTGTTATGTCAGGATTTTTAACTGTTTTGCTTGTAA
CTTGTTTTATTTTTCTGGCGTTCGATTTGCTACGTCCGGCCTTAACCGCTCATTTATCCAATATGGCCGGTAACCAGCAG
GGTTTCGTAGCAGGCATGAACTCCACATACACCAGCCTGGGAAATATATTTGGACCTGCTCTAGGCGGTATACTATTTGA
TCTTAACATTCATTATCCTTTCCTTTTTGCAGGTTTCGTTATGATTGTCGGCCTTGGTCTTACAATGGTTTGGAAAGAAA
AAAAGAATGATGCTGCAGCTTTGAATTAA