MEGAResFrom MEG, the Microbial Ecology Group

ABES

The abeS gene encodes an SMR family efflux pump in Acinetobacter baumannii.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|NC_011595|1249018-1249348|ARO:3000768|abeS|Multi-drug_resistance|Multi-drug_efflux_pumps|ABES
TTATAGATGGGTGTTTTTAGAAAACACATTAATAATCACAATGCCTGCGATCATTAAAGCTAAACCAATGCAGGCAGCTA
AGTCTAAATGTTGTTTGTAAAATATCCAGCCAATTGCAGAAATTAAAATAATACCTGCGCCTGACCAAATGGCATAGGCA
ATCCCGATTGGAATTGTTTTGAGCGTAAGAGATAATAAATAAAAAGCAACTGCATAACCCACAACTGTAATAATAGACGG
AATTGGAACAGTAAAACCTTGAGATGCTTTTAATGCTGAAGTTGCAATAACTTCACAAGCAATCGCAATTGCTAAATAAA
GATAAGACATG