MEGAResFrom MEG, the Microbial Ecology Group

ABEM

The abeM gene encodes a multi-drug efflux pump in Acinetobacter baumannii.

References

Other Groups in Multi-drug efflux pumps

Sequences

Download Sequences

>CARD|phgb|AB204810|186-1533|ARO:3000753|abeM|Multi-drug_resistance|Multi-drug_efflux_pumps|ABEM
GTGTCGAATGTCACGTCGTTTCGGTCTGAATTAAAACAACTCTTCCATTTAATGTTACCTATTTTAATTACGCAGTTTGC
TCAAGCAGGGTTCGGGTTAATTGATACCATTATGGCTGGGCATTTATCTGCCGCAGACTTAGCCGCTATTGCGGTAGGTG
TAGGCTTATGGATTCCAGTCATGCTCTTGTTCAGTGGCATCATGATTGCAACCACACCATTAGTTGCCGAAGCAAAAGGC
GCTAGAAATACAGAGCAAATTCCAGTGATTGTCCGCCAATCATTATGGGTTGCAGTAATTCTAGGGGTATTGGCAATGCT
CATTTTGCAGCTTATGCCATTTTTCTTACATGTGTTTGGCGTACCAGAAAGTTTACAACCTAAAGCCAGTTTATTCTTAC
ATGCAATTGGTTTGGGTATGCCCGCTGTAACCATGTATGCAGCGCTCCGAGGCTATTCCGAAGCATTAGGCCATCCCCGC
CCTGTCACGGTCATTAGCTTACTAGCCTTAGTGGTTTTAATCCCGCTTAACATGATTTTTATGTATGGCTTAGGACCAAT
ACCTGCTTTGGGTAGCGCAGGCTGTGGTTTTGCAACATCCATTTTACAGTGGCTGATGCTCATTACGTTAGCAGGCTATA
TTTATAAGGCTTCGGCTTATCGAAACACATCTATTTTTAGCAGATTCGATAAAATTAGCCTGACTTGGGTTAAAAGAATT
TTACAGCTCGGCCTGCCAATTGGTTTAGCTGTGTTTTTTGAAGTGAGTATTTTTAGTACAGGGGCATTGGTCCTTAGCCC
TCTAGGGGAAGTCTTTATTGCCGCACACCAAGTAGCAATTTCAGTCACTTCGGTACTGTTTATGATTCCACTTTCTCTTG
CCATTGCTTTAACCATTCGCGTGGGGACGTATTATGGTGAAAAGAACTGGGCTTCCATGTACCAAGTACAGAAAATTGGT
CTAAGCACAGCAGTATTTTTTGCTCTATTGACCATGTCTTTTATTGCTTTAGGCCGTGAACAAATTGTCTCGGTTTATAC
TCAAGATATAAATGTTGTGCCGGTTGCCATGTATTTGCTCTGGTTTGCAATGGCATATCAATTAATGGATGCTCTACAAG
TCAGCGCTGCCGGCTGTTTAAGAGGTATGCAAGATACTCAGGCACCGATGTGGATCACCTTAATGGCGTATTGGGTAATT
GCTTTTCCAATCGGTCTTTATTTAGCGCGTTATACCGATTGGGGCGTAGCTGGTGTGTGGTTAGGTTTAATTATTGGTTT
AAGTATTGCCTGTGTTTTATTGCTATCACGACTCTATTTGAATACCAAACGTTTAAGTCAAACCTAAT