MEGAResFrom MEG, the Microbial Ecology Group

EMRE

The emrE gene encodes a multi-drug efflux pump in Escherichia coli.

References

  • http://aac.asm.org/content/45/4/1126.full

Sequences

Download Sequences

>>MEG_2731|Drugs|Multi-drug_resistance|Multi-drug_SMR_efflux_regulator|EMRE
ATGACCAACTATCTCTACCTCGCCATCGCCATCGCCGCCGAAGTGGTCGCCACCACCTCGCTGAAAGCCGTCGCCGGATT
CAGCAAGCCACTGCCGCTGCTGCTGGTGGTGGGCGGCTACGTGCTCGCCTTCAGCATGCTCGTGCTGGTCATGCGCACCC
TGCCGGTCGGCGTGGTCTACGCCATCTGGTCCGGACTCGGCATCGTCCTGGTCAGCCTGGTGGCGATGTTCGTCTACGGC
CAGCGCCTGGACCCCGCCGCCCTCCTCGGCATCGGCCTGATCATCGCCGGCGTGCTGGTGATCCAGTTGTTCTCCCGCGC
TTCGGGGCACTGA