MEGAResFrom MEG, the Microbial Ecology Group

NALD

The nalD gene encodes a transcriptional regulator of the MexAB-OprM efflux system in Pseudomonas aeruginosa.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1087681/

Other Groups in Multi-drug RND efflux regulator

Sequences

Download Sequences

>>MEG_4110|Drugs|Multi-drug_resistance|Multi-drug_RND_efflux_regulator|NALD|RequiresSNPConfirmation
ATGCGACGCACAAAGGAAGATTCTGAAAAAACCCGTACGGCCATCCTCCTGGCCGCCGAGGAACTGTTCCTGGAAAAGGG
CGTGTCCCATACCAGCCTGGAACAGATCGCCAGGGCCGCCGGGGTGACCCGTGGCGCCGTCTACTGGCACTTCCAGAACA
AGGCCCACCTGTTCAACGAGATGCTCAACCAGGTACGCCTGCCGCCGGAGCAACTCACCGAGCGCCTGTCCGGCTGCGAT
GGCAGCGACCCGCTGCGCTCGCTCTACGACCTCTGCCTGGAGGCCGTGCAATCGTTGCTGACGCAGGAGAAGAAGCGCCG
CATCCTGACCATCCTGATGCAACGTTGCGAATTCACCGAGGAACTGCGCGAGGCGCAGGAACGCAACAACGCCTTCGTGC
AGATGTTCATCGAACTCTGCGAGCAGTTGTTCGCCCGCGACGAATGCCGTGTGCGGCTGCATCCGGGCATGACCCCGAGG
ATCGCCTCGCGCGCCTTGCACGCGCTGATCCTGGGCCTGTTCAACGACTGGTTGCGCGACCCGCGCCTGTTCGATCCGGA
TACGGACGCGGAACACCTGCTGGAGCCGATGTTCCGTGGCCTGGTGCGCGACTGGGGTCAGGCCAGCTCGGCGCCGTAG