MEGAResFrom MEG, the Microbial Ecology Group

SDIA

The sdiA gene encodes a LysR family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Other Groups in Multi-drug RND efflux pumps

Sequences

Download Sequences

>>MEG_6176|Drugs|Multi-drug_resistance|Multi-drug_RND_efflux_pumps|SDIA
ATGCAGGAAAATGATTTCTTCACCTGGCGACGCGCAATGTTGTTACGCTTTCAGGAGATGGCGGCAGCAGAGGATGTTTA
TACTGAATTGCAATATCAGACACAGCGGCTGGAATTTGATTATTATGCCCTGTGTGTTCGTCATCCCGTCCCCTTTACCC
GGCCTAAAATATCGCTTCGTACCACTTATCCTCCGGCGTGGGTAACGCATTACCAGTCCGAAAACTATTTCGCGATCGAT
CCGGTATTAAAGCCGGAAAATTTCAGGCAGGGTCATTTACATTGGGATGACGTGCTATTTCATGAAGCGAAGGCGATGTG
GGATGCCGCCCAGCGTTTCGGATTACGCAGAGGCGTAACCCAGTGTGTGATGTTGCCGAACCGGGCGCTGGGCTTTTTAT
CTTTCTCCCGTAGCAGTTTACGCTGCTCCTCGTTTACCTACGACGAAGTGGAGCTGAGGTTGCAACTGCTGGCGCGGGAG
AGTCTTTCGGCGCTGACAAGATTTGAAGACGACATGGTGATGGCGCCTGAAATGCGTTTCAGTAAACGTGAGAAAGAGAT
TCTGAAGTGGACGGCGGAAGGGAAGACCTCATCGGAGATCGCCATTATTCTGTCGATTTCTGAAAATACCGTTAACTTCC
ATCAGAAAAATATGCAGAAGAAATTCAATGCGCCAAATAAAACACAGATTGCCTGCTACGCTGCGGCGACAGGTCTGATA
TGA