MEGAResFrom MEG, the Microbial Ecology Group

TAP

The tap gene encodes an efflux pump in Mycobacterium fortuitum.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/16373429

Other Groups in Multi-drug MFS efflux pumps

Sequences

Download Sequences

>>MEG_6644|Drugs|Multi-drug_resistance|Multi-drug_MFS_efflux_pumps|TAP
ATGACGAACACCAAGCGCGGCCCCTTGCTGCTGATCCTGTTCGCCGCGTTGACGGCCGGCGCCGGCAACGGAATCACCAT
CGTCGCGTTCCCGTGGCTGGTGTTGCAGCACAACGGATCCGCGCTCGACGCCTCGATCGTCGCGATGGCCGGCACCCTGC
CGCTGCTGGTGGCCACACTGATCGCCGGGGCGGCGGTGGATTACCTGGGTCGCCGACGGGTTTCGATGATCTCGGATCTG
CTCTCGGCGCTGTCGGTCGCTGCGGTACCCGTGCTGGCCCTGATTTTCGGGGTGGACGCGGTCAATGTCGCGGTGCTGGC
GGTCCTGGCGGGGCTGGGAGCGTTCTTCGACCCGGCCGGCATGACAGCGCGCGAGACCATGCTGCCCGAGGCCGCGGGCC
GGGCCGGTTGGACGCTGGACCATGCCAACTCGGTGTACGAGGCGGTCTTCAACCTGGGCTACATCGTCGGCCCCGGTATC
GGCGGCCTGATGATCGCCACGCTCGGCGGGATCAACACCATGTGGGTGACGGCCGGGGCGTTCTGCTGCTCGATCCTGGC
CATCTCGGTGCTGCGACTGGAGGGCGCGGGCGCGCCGGACCGCTCGGTGCTGACCGAGGCCGTTTTGGCGGGCATAGTCG
AGGGACTGCGATTCGTCTGGTACACACCGGTATTGCGCACCCTGGCCATCGTCGACCTGGTGGCCACCGGCTTGTACATG
CCGATGGAATCGGTCCTTTTTCCGAAGTACTTCACGGACCGGAACGAACCCACCGAACTGGGCTGGGTGCTGATGGCGTT
GAGCATCGGCGGACTGTTGGGTGCGCTCGGTTACGCCGTGATGTCCAGGTACATGAGCCGACGGGCCACCATGCTGACCG
CCGTGATCACCCTCGGGGTGGCGATGACGGTGATCGCCTTCCTGCCACCGCTGCCGCTGATCCTGGTGCTGTGCGCAATC
GTCGGCTTCGTCTACGGACCGATCGCACCCATCTACAACTACGTCATGCAGACCACCGCTCCCCAACACCTGCGTGGCCG
CGTGGTCGGGGTGATGGGCTCATTGGCCTACGCCGCGGGCCCGCTCGGGCTGATCCTGGCCGGGCCGCTGGCCGACGCCG
CAGGCCTGCACGCGACGTTCCTGGCACTGTCCCTACCGATGCTGTTGCTCGGCGTCGTGGCGGTGTTCCTGCCGCGGCTG
CGCGAGCTGGACCTAGCATCGAAACCGTGA