MEGAResFrom MEG, the Microbial Ecology Group

MEPB

The mepB gene encodes a protein thought to be involved with the mep efflux system, but this is unconfirmed.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/24501097

Other Groups in Multi-drug MATE efflux pump

Sequences

Download Sequences

>>MEG_3835|Drugs|Multi-drug_resistance|Multi-drug_MATE_efflux_pump|MEPB
ATGTGTAAATCTAAAATACTGTTGAAAAATATTTTTAGTGAAGAATCAGAAGTTAAAGATTTAACTGAAGAAAAATATAA
TCAAGATTACGAAGCATTAACATTTAGCTTTAAAGAGGAAACATATCAAAGTAGGTTAGCTAAGAAAACACCGACTAAAT
CGGGATATTTCGTGACATGTTGGACAAAAGACGAAGATAATTATAATCGGCCATACAAAATTGAAGAGTTTGCTGATTAC
CTGATTGTTGCTGTTATCGATGATGAATTAAATGGCTACTTTCTATTTCCTAGGGAATTATTGGTAGAAAAAGGTATCTT
AGCTTCATCTAAGTATCAAGGGAAAATGGCTTTTAGAGTTTATCCTAAGTGGTGTAATCAATTGAATAAAACAGCAGGGC
AAACACAAAAGTGGCAATGTAAATATTTTTTTGAATACTAA