MEGAResFrom MEG, the Microbial Ecology Group

SRMB

The srmB gene encodes a spiramycin efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2763196/

Other Groups in Multi-drug ABC efflux pumps

Sequences

Download Sequences

>>MEG_6558|Drugs|Multi-drug_resistance|Multi-drug_ABC_efflux_pumps|SRMB
GTGTCGATTGCGCAATACGCCCTACACGACATCACGAAGCGCTACCACGACTGTGTCGTGCTCGACCGGGTCGGTTTCAG
CATCAAGCCGGGCGAGAAGGTCGGCGTGATCGGCGACAACGGTTCCGGCAAGTCCACGCTGCTCAAGATCCTCGCCGGCC
GCGTGGAGCCCGACAACGGCGCGCTCACCGTGGTCGCTCCCGGCGGCGTCGGCTACCTGGCGCAGACACTGGAACTGCCC
CTCGACGCCACCGTCCAGGACGCCGTCGACCTGGCCCTGTCCGACCTGCGCGAGCTCGAAGCGGCGATGCGCGAGGCCGA
GGCGGAGCTGGGCGAGAGCGACGAGAACGGCTCCGAGCGCGAGCTGTCCGCCGGCCTCCAGCGCTACGCCGCTCTGGTCG
AGCAGTACCAGGCGCGTGGCGGCTACGAGGCCGACGTGCGCGTGGAGGTCGCGCTGCACGGCCTCGGACTGCCGAGCCTG
GACCGCGACCGCAAGCTCGGAACCCTCTCCGGTGGCGAACGCTCCCGCCTCGCGCTCGCCGCGACCCTCGCCTCGTCGCC
GGAGCTGCTGCTCCTGGACGAACCGACCAACGACCTCGACGACCGGGCGATGGAATGGCTGGAGGACCACCTGGCCGGCC
ACCGCGGCACGGTGATCGCGGTCACCCACGACCGGGTCTTCCTCGACCGGCTCACCACCACGATCCTGGAGGTCGACTCC
GGCAGCGTCACCCGCTACGGCAACGGCTACGAGGGCTACCTGACGGCCAAGGCCGTGGAACGCGAGCGGCGGCTGCGGGA
GTACGAGGAGTGGCGTGCCGAACTCGACCGCAACCGCGGGCTGATCACCTCCAACGTGGCGCGGATGGACGGCATCCCGC
GCAAGATGTCCCTCTCCGTGTTCGGCCACGGCGCCTACCGCAGGCGAGGGCGCGACCACGGCGCGATGGTGCGGATCCGC
AACGCGAAGCAACGCGTGGCGCAGCTGACCGAGAACCCGGTCCACGCTCCCGCCGACCCGTTGTCCTTCGCCGCCCGCAT
CGACACCGCGGGCCCGGAGGCGGAGGAGGCGGTGGCCGAACTCACCGACGTGCGCGTCGCGGGTCGGCTCGCCGTGGACT
CCCTGACGATCCGGCCCGGCGAACGGCTGCTCGTCACAGGTCCCAACGGTGCGGGCAAGTCCACCTTGTTGCGGGTGCTG
TCCGGGGAACTGGAGCCGGACGGCGGCTCGGTGCGCGTCGGCTGCCGGGTCGGTCATCTGCGGCAGGACGAGACGCCCTG
GGCGCCCGGACTGACCGTGCTGCGGGCCTTCGCCCAGGGCCGGGAGGGCTACCTGGAGGACCACGCGGAGAAACTGCTGT
CGCTCGGCCTGTTCAGCCCGTCCGACCTGCGGCGACGCGTGAAGGATCTGTCCTACGGGCAGCGCCGCCGGATCGAGATC
GCCCGGCTGGTGAGCGACCCGATGGACCTGCTGCTGCTGGACGAGCCCACCAACCACCTCACCCCGGTGCTGGTGGAGGA
GTTGGAGCAGGCACTCGCGGACTACCGCGGCGCCGTCGTGGTCGTCACCCACGACCGTCGGATGCGGTCCCGGTTCACCG
GCGCCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGCGCCGGCTGA