MEGAResFrom MEG, the Microbial Ecology Group

MSBA

The msbA gene encodes a multi-drug efflux system in Vibrio cholera.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12823979

Other Groups in Multi-drug ABC efflux pumps

Sequences

Download Sequences

>>MEG_4061|Drugs|Multi-drug_resistance|Multi-drug_ABC_efflux_pumps|MSBA
ATGCATAACGACAAAGATCTCTCTACGTGGCAGACATTCCGCCGACTGTGGCCAACCATTGCGCCTTTCAAAGCGGGTCT
GATCGTGGCGGGCGTAGCGTTAATCCTCAACGCAGCCAGCGATACCTTCATGTTATCGCTCCTTAAGCCACTTCTTGATG
ATGGCTTTGGTAAAACAGATCGCTCCGTGCTGGTGTGGATGCCGCTGGTGGTGATCGGGCTGATGATTTTACGTGGTATC
ACCAGCTATGTCTCCAGCTACTGTATCTCCTGGGTATCAGGAAAGGTGGTAATGACCATGCGTCGCCGCCTGTTTGGTCA
CATGATGGGAATGCCAGTTTCATTCTTTGACAAACAGTCAACGGGTACGCTGTTGTCACGTATTACCTACGATTCCGAAC
AGGTTGCTTCTTCTTCTTCCGGCGCACTGATTACTGTTGTGCGTGAAGGTGCGTCGATCATCGGCCTGTTCATCATGATG
TTCTATTACAGTTGGCAACTGTCGATCATTTTGATTGTGCTGGCACCGATTGTTTCGATTGCGATTCGCGTTGTATCGAA
GCGTTTTCGCAACATCAGTAAAAACATGCAGAACACCATGGGGCAGGTGACCACCAGCGCAGAACAAATGCTGAAGGGCC
ACAAAGAAGTATTGATTTTCGGTGGTCAGGAAGTGGAAACGAAACGCTTTGATAAAGTCAGCAACCGAATGCGTCTTCAG
GGGATGAAAATGGTTTCAGCCTCTTCCATCTCTGATCCGATCATTCAGCTGATCGCCTCTTTGGCGCTGGCGTTTGTTCT
GTATGCGGCGAGCTTCCCAAGTGTCATGGATAGCCTGACTGCCGGTACGATTACCGTTGTTTTCTCTTCAATGATTGCAC
TGATGCGTCCGCTGAAATCGCTGACCAACGTTAACGCCCAGTTCCAGCGCGGTATGGCGGCTTGTCAGACGCTGTTTACC
ATTCTGGACAGTGAGCAGGAGAAAGATGAAGGTAAGCGCGTGATCGAGCGTGCGACTGGCGACGTGGAATTCCGCAATGT
CACCTTTACTTATCCGGGACGTGACGTACCTGCATTGCGTAACATCAACCTGAAAATTCCGGCAGGGAAGACGGTTGCTC
TGGTTGGACGCTCTGGTTCGGGTAAATCAACCATCGCCAGCCTGATCACGCGTTTTTACGATATTGATGAAGGCGAAATC
CTGATGGATGGTCACGATCTGCGCGAGTATACCCTGGCGTCGTTACGTAACCAGGTTGCTCTGGTGTCGCAGAATGTCCA
TCTGTTTAACGATACGGTTGCTAACAACATTGCTTACGCACGGACTGAACAGTACAGCCGTGAGCAAATTGAAGAAGCGG
CGCGTATGGCCTACGCCATGGACTTCATCAATAAGATGGATAACGGTCTCGATACAGTGATTGGTGAAAACGGCGTGCTG
CTCTCTGGCGGTCAGCGTCAGCGTATTGCTATCGCTCGAGCCTTGTTGCGTGATAGCCCGATTCTGATTCTGGACGAAGC
TACCTCGGCTCTGGATACCGAATCCGAACGTGCGATTCAGGCGGCACTGGATGAGTTGCAGAAAAACCGTACCTCTCTGG
TGATTGCCCACCGCTTGTCTACCATTGAAAAGGCAGACGAAATCGTGGTCGTCGAGGATGGTGTCATTGTGGAACGCGGT
ACGCATAACGATTTGCTTGAGCACCGCGGCGTTTACGCGCAACTTCACAAAATGCAGTTTGGCCAATGA