MEGAResFrom MEG, the Microbial Ecology Group

LMRA

The lmrA gene encodes a protein that has significant similarities to the methylenomycin-resistance protein (Mmr) of Streptomyces coelicolor. This gene has been implicated in resistance to lincomycin.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/1328813

Other Groups in Multi-drug ABC efflux pumps

Sequences

Download Sequences

>>MEG_3594|Drugs|Multi-drug_resistance|Multi-drug_ABC_efflux_pumps|LMRA|RequiresSNPConfirmation
ATGTCTGTCTTCGCTCGTGCCACCTCGCTCTTCTCCCGTGCCGCGCGGACCCGCGCGGCCGATGAGGCGGCCCGTTCCCG
GTCTCGCTGGGTCACCCTCGTCTTCCTCGCCGTGCTCCAGCTCCTCATCGCGGTCGACGTGACCGTAGTGAACATCGCCC
TGCCTGCGATCCGCGACAGCTTCCACGTCGACACCCGTCAACTCACCTGGGTAGTCACGGGTTACACCGTCGTGGGCGGC
GGCCTGCTCATGGTGGGCGGGCGCATCGCCGACCTCTTCGGGCGGCGCCGGACCCTCCTTTTCGGGGCCTTCCTCTTCGG
TGCGTCGTCCCTCGCCGCGGGCCTCGCCCCGAACCTGGAGCTGCTCGTGCTCGCACGGTTCGGGCAGGGCGCAGGAGAGG
CCCTCTCCCTGCCGGCCGCGATGTCGCTCATCGCCTGCTCTTCCCGAACCGCGCCGTTCCAAGGCGTTGAGCGTCTGGCG
TCGGTCGCCAGCGTCGGCCTCGTCCTCGGCTTCCTGCTCTCCGGGGTCATCACCCAGCTCTTCAGCTGGCGTTGGATCTT
CCTGATCAACATCCCCCTCGTCAGCCTCGTGCTCGTCGCCGTACTGCTGCTGGTCAAGAAGGACGAGACGACCGCACGCA
ATCCCGTCGACCTCCCCGGCGCGCTCCTCTTCACGGCCGCGCCGCTGCTGCTCATCTTCGGCGTCAACGAGCTGGGCGAG
GACGAGCCCCGGCTGCCGCTCGCCGTCGGGAGCCTGCTCGCGGCCGCGGTGTGCGCGGCCGCGTTCGTCGCCGTCGAGCG
GCGCACGGCCCATCCCCTGGTTCCCCTGACGTTCTTCGGGAACCGCGTCCGCCTGGTCGCCAACGGCGCCACGGTCCTCC
TCAGCGCCGCCCTCTCGACCTCCTTCTTCCTGCTGACCATGCACTTGCAGGAGGAGCGCGACCTGTCCCCCATCGAGGCG
GGACTGTCCTTCCTGCCCCTGGGCCTCAGCCTCATCCTCGCCTGCGTCCTCGTCCGGGGCCTCATCGAGCGCATCGGCAC
CACCGGCGCGGCGGTGCTCGGCATGGCGCTCGCGGGCCCTCGGCATCGGCTCTTCGCGCTGCTGCCCAGCGACAACTCGC
TGCTCACCAGCGTCTTCCCCGGCATGATCCTGCTCCTGCGGATGGCCACCGGCCTGGTCGCATTGCAGAACGCCGCCCTG
CACGCGGTCACCGAGGCCGACGCGGGCGTGGCCTCCGGCGTGCAACGCTGCGCCGACCAGCTCGGCGGCGCGAGCGGTAT
CGCCGTCTACGTCAGCATCGGGTTCTCGCCCCACCTCGGCGGCGACTGGGACCCGTTCACCGTGGCGTACAGCCTCGCCG
GCATCGGCCTGATCGCGGCCGTCCTCGCCGTCCTCGCCCTGTCTCCGGACCGCCGTCTCGCCGCCCCCCGGGAGCAGGAG
GACTGA