MEGAResFrom MEG, the Microbial Ecology Group

CARA

The carA gene encodes an efflux pump that has been shown to function on macrolides.

References

  • http://aac.asm.org/content/44/4/967.full

Other Groups in Multi-drug ABC efflux pumps

Sequences

Download Sequences

>>MEG_1491|Drugs|Multi-drug_resistance|Multi-drug_ABC_efflux_pumps|CARA
GTGTCGACAGCGCAACTAGCTCTGCATGACATCACCAAGCGTTACCAGGACCACGTCGTACTCGACCGGATCGGCTTCAC
CATCAAGCCGGGCGAGAAGGTCGGTGTCATCGGGGACAACGGATCCGGCAAGTCCACGCTGATCAAGCTCATCGCCGGGC
GGGAACAGCCGGACAACGGTGCGGTGACGGTGGTCGCGCCCGGTGGCGTCGGCTATCTGGCCCAGACACTGGAGCTGCCG
CTGGAGGCCACGGTCCAGGACGCCGTCGATCTGGCCCTGGCCGACCTGCGGGAGCTGGAGGAGGGCATGCGCCGGACCGA
GGCCGAGCTGGCCGAACGGCCCTACCAAACGGGCCAAGACCCCGAACTCGCCGGCCTCCTGGAGAGTTACGCCGCGCTGG
TGGACCGGTATCAGGCCCGCGGCGGCTACGAGGCCGACTCCCGCGTGGAGATCGCGCTGCACGGGCTCGGGCTGCCCGGG
CTGGAACGCGGCCGGCGGCTGGGCACCCTGTCCGGCGGCGAGCGCTCGCGCCTCGCCCTGGCGGCGACGCTGGCCTCGGA
ACCCGAACTGCTGCTGTTGGACGAGCCGACCAACGACCTGGACGACCGGGCCGTGGACTGGCTGGAGGAACACCTGCGCA
AGCACAAAGGCACCGTTGTCGCCGTTACCCACGACCGGCTCTTCCTCGACCGGCTCACCACCACGATCCTGGAGATCGAC
TCCGGCAAGGTGATGCGCTACGGCAACGGCTACGAGGGCTACCTGGCAGCCAAGGCGGCGGAACGGCAGCGCAGGCTGCT
TGAGTACGAGCAGTGGCGCGCCGAGCTGGACCGCAGCCGCGACCTGATCGCGTCCAACGTGGCGCGTCTGGACGCCATCC
CACGCAAGCTGCCCTTCGCCGTCTTCGGCGCCGGCCAGTTCCGGATGCGCGGGCGGGGCCATGGTGCGATGGTGCGGATC
CGCAACGCCAAGGAACGCGTCGCGCGGCTGACCGAAAACCCGGTCGCGCCGCCGCCCGAGCCGCTCACCTTCACCGCGGA
GATCACCACCGAGGCCGCGCAGTCCCGGGAGACGGTGGCCGAACTCACCGGCGTCCGGGTCGGCGACCGGCTCAGCGTCG
ACTCCCTGCACCTCGGGCCCGGTGAACGGCTGCTGGTCACCGGCCCCAACGGGGCGGGCAAGACGACGCTGCTGCGGGTG
CTCTCCGGGGAGCTGGAACCCGACAGCGGATCCCTGCTGGTGTCGGGCCGGGTGGGACACCTGAGGCAGGAACAGACACC
ATGGCGGCCGGGTATGACGGTGCTTCAGGCGTTCAGCAGCGGACGGGCCGGTGACATCGACGAGCACACCGAGGCGCTGC
TCTCCCTCGGGCTGTTCAGCCCGGACGACCTCCGCCAGCGTGTGCAGGACCTGTCGTACGGGCAGCGGCGCCGCATCGAG
CTTGCCCGGCTGGTGACGGAGCCGGTCGACCTGCTGCTGCTGGACGAACCCACCAACCACCTCTCGCCCGCGCTCGTCGA
GGAACTGGAGGAGGCGCTGACCGGTTATCAGGGCACGGTCGTCGTCGTCACCCACGACCGGCGCATGCGGTCCCGCTTCA
ACGGCGCCCATCTGACGCTGCAGGACGGGCGCGTCGCCGAGTTCACCGCCGCCTGA