MEGAResFrom MEG, the Microbial Ecology Group

tetR

Resistance to tetracycline is regulated by the tetR gene in gram-negative bacteria, and this gene has been shown to regulate multi-drug efflux as well. A protein family of this same name is also a transcriptional regulator class.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>MLS|AB000617.1|gene3|Multi-drug_resistance|MDR_regulator|tetR|RequiresSNPConfirmation
ATGAGTTATGGAGATTCCCGTGAGAAAATCCTTTCGGCAGCTACCCGGCTTTTTCAGCTGCAAGGGTATTACGGCACGGG
GCTGAACCAGATTATAAAGGAAAGCGGCGCGCCTAAAGGCTCTCTTTACTACCACTTTCCCGGGGGTAAAGAACAGCTTG
CGATCGAAGCCGTGAATGAGATGAAGGAGTATATCCGTCAGAAAATCGCGGACTGCATGGAAGCCTGCACCGATCCAGCG
GAAGGCATTCAAGCCTTTTTGAAGGAGCTCTCCTGCCAGTTTTCATGTACGGAAGACATTGAAGGCTTGCCTGTGGGCTT
GCTAGCGGCTGAGACGTCATTGAAAAGCGAACCGTTGCGCGAAGCCTGTCATGAAGCCTACAAAGAATGGGCCTCTGTGT
ATGAGGAAAAACTGCGGCAGACTGGCTGCAGCGAGAGCCGTGCAAAAGAAGCCAGCACTGTGGTTAACGCGATGATTGAA
GGCGGCATCCTTTTATCTTTGACGGCAAAAAACAGTACGCCGCTCCTTCATATCTCCAGCTGCATTCCTGACCTGCTGAA
GAGATAA

>Mdr|NC_002516.2.880362|Multi-drug_resistance|MDR_regulator|tetR|RequiresSNPConfirmation
ATGAACGATGCTTCTCCCCGTCTGACCGAACGCGGCAGGCAACGCCGCCGCGCCATGCTCGACGCCGCTACCCAGGCCTT
TCTCGAACACGGTTTCGAAGGCACCACCCTGGACATGGTGATAGAACGGGCCGGTGGTTCACGGGGGACCCTGTACAGCT
CCTTCGGCGGCAAGGAGGGCCTGTTCGCCGCGGTGATCGCCCACATGATCGGGGAAATCTTCGACGACAGCGCCGATCAG
CCGCGCCCCGCCGCCACGCTGAGCGCCACCCTCGAGCATTTCGGCCGGCGCTTTCTCACCAGCCTGCTCGATCCCCGCTG
CCAGAGCCTCTATCGCCTGGTGGTGGCGGAATCCCCGCGGTTTCCGGCGATCGGCAAGTCCTTCTACGAGCAGGGGCCGC
AGCAGAGCTATCTGCTGCTCAGCGAGCGACTGGCCGCGGTCGCTCCTCACATGGACGAGGAAACGCTCTACGCGGTGGCC
TGCCAGTTTCTCGAGATGCTCAAGGCCGACCTGTTCCTCAAGGCCCTCAGCGTGGCCGACTTCCAGCCGACCATGGCGCT
GCTGGAAACCCGCCTCAAGCTGTCGGTGGACATCATCGCCTGCTACCTGGAACACCTGTCGCAGAGCCCCGCGCAGGGCT
GA