MEGAResFrom MEG, the Microbial Ecology Group

SOXS

The soxS gene encodes a AraC family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|AE004091.2|2503424-2503895|ARO:3000836|soxR|Multi-drug_resistance|MDR_regulator|SOXS|RequiresSNPConfirmation
CTAGCCGTCGTGCTCGCGGCCCTCGGCGTCCAGCCAGTGCGCTCCCGGCCCCTCGGCGGAAAGCTGGTCGCCGGGGTTGC
GCAACGGGCAGGCCTGGAGCGACAGGCAGCCGCAACCGATGCAGCCGTCCAGTTGGTCGCGCAACAGCAGCAGCTTGTCG
ATGCGCTCGGTGAGATCCTCCTTCCACTGCGCCGACAGGCGCGCCCAGTCCGCCGCGCTAGGGCTGCGCCCCGCCGGCAG
GGTCTGCAGGGCGCGAGCGATCTCCGCGAGGGGAATGCCGACCCGCTGGGCGACCTTGATCACCACCACCCGGCGTAGCG
TCTCGCGACTGAAGCGCCGCTGGTTGCCGGCGTTGCGCTGGCTGCTGATCAGCCCCTTGGTTTCGTAGAAATGCAGGGCG
GAGACCGCCACGCCGGCACGCCTGGCCAGTTCGCCGACGCTCAGTTCACGAGATGCGCAGGAATTCTTCAT

>CARD|pvgb|NC_003197|4503969-4504293|ARO:3003383|Salmonella|Multi-drug_resistance|MDR_regulator|SOXS|RequiresSNPConfirmation
CTACAGGCGGTGACGGTAATCGCTGGGAGTGCGATCGAACTCGCGGCGGAATACACGCGAGAAGGTTTGCTGCGATACAT
AGCCCAGGTCCATCGCGATATCAAAAATCGGGCGCTCGGTCGTTCGTAGCTCAACGGCCGCCAACAGGAGACGGCGCTGG
CGAATATACTCGCCTAATGTTTGATGCGTTACCGTACGAAACATCCGCTGCAAATACCACTTGGAGTAGCCCGATTTTTT
TGCCACCACATCAATGTTTAGCGGTTGGTCGATATGTTCATCAATCCATTCGATAAGGGTCTGAATTATCTGCTGATGCG
ACATA

>CARD|pvgb|U00096|4277468-4277933|ARO:3003381|Escherichia|Multi-drug_resistance|MDR_regulator|SOXS|RequiresSNPConfirmation
ATGGAAAAGAAATTACCCCGCATTAAAGCGCTGCTAACCCCCGGCGAAGTGGCGAAACGCAGCGGTGTGGCGGTATCGGC
GCTGCATTTCTATGAAAGTAAAGGGTTGATTACCAGTATCCGTAACAGCGGCAATCAGCGGCGATATAAACGTGATGTGT
TGCGATATGTTGCAATTATCAAAATTGCTCAGCGTATTGGCATTCCGCTGGCGACCATTGGTGAAGCGTTTGGCGTGTTG
CCCGAAGGGCATACGTTAAGTGCGAAAGAGTGGAAACAGCTTTCGTCCCAATGGCGAGAAGAGTTGGATCGGCGCATTCA
TACCTTAGTGGCGCTGCGTGACGAACTGGACGGATGTATTGGTTGTGGCTGCCTTTCGCGCAGTGATTGCCCGTTGCGTA
ACCCGGGCGACCGCTTAGGAGAAGAAGGTACCGGCGCACGCTTGCTGGAAGATGAACAAAACTAAA