MEGAResFrom MEG, the Microbial Ecology Group

SDIA

The sdiA gene encodes a LysR family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_003197|2039657-2040380|ARO:3000826|sdiA|Multi-drug_resistance|MDR_regulator|SDIA
TCATATCAGACCTGTCGCCGCAGCGTAGCAGGCAATCTGTGTTTTATTTGGCGCATTGAATTTCTTCTGCATATTTTTCT
GATGGAAGTTAACGGTATTTTCAGAAATCGACAGAATAATGGCGATCTCCGATGAGGTCTTCCCTTCCGCCGTCCACTTC
AGAATCTCTTTCTCACGTTTACTGAAACGCATTTCAGGCGCCATCACCATGTCGTCTTCAAATCTTGTCAGCGCCGAAAG
ACTCTCCCGCGCCAGCAGTTGCAACCTCAGCTCCACTTCGTCGTAGGTAAACGAGGAGCAGCGTAAACTGCTACGGGAGA
AAGATAAAAAGCCCAGCGCCCGGTTCGGCAACATCACACACTGGGTTACGCCTCTGCGTAATCCGAAACGCTGGGCGGCA
TCCCACATCGCCTTCGCTTCATGAAATAGCACGTCATCCCAATGTAAATGACCCTGCCTGAAATTTTCCGGCTTTAATAC
CGGATCGATCGCGAAATAGTTTTCGGACTGGTAATGCGTTACCCACGCCGGAGGATAAGTGGTACGAAGCGATATTTTAG
GCCGGGTAAAGGGGACGGGATGACGAACACACAGGGCATAATAATCAAATTCCAGCCGCTGTGTCTGATATTGCAATTCA
GTATAAACATCCTCTGCTGCCGCCATCTCCTGAAAGCGTAACAACATTGCGCGTCGCCAGGTGAAGAAATCATTTTCCTG
CATA