MEGAResFrom MEG, the Microbial Ecology Group

ROBA

The robA gene encodes a transcriptional regulator that is linked to multi-drug resistance through the AcrAB efflux system in Escherichia coli.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|JQ727667|0-870|ARO:3000825|robA|Multi-drug_resistance|MDR_regulator|ROBA
ATGGATCAGGCTGGAATTATTCGCGACCTGCTCACCTGGCTGGAAGGTCATCTCGACCAGCCTTTGTCACTGGATAATGT
GGCGGCAAAAGCAGGCTATTCCAAGTGGCATCTGCAAAGGATGTTCAAGGATGTCACCGGTCATGCTATCGGTGCCTATA
TTCGCGCACGTCGTTTATCAAAGTCTGCTGTTGCGTTGCGCCTGACCGCGCGACCAATCCTGGATATTGCCCTGCAATAT
CGTTTCGATTCGCAGCAAACCTTCACCCGCGCCTTTAAAAAACAGTTCTCGTTAACGCCAGCGCTTTATCGCCGCTCGCC
GGACTGGAGCTCCTTTGGTATGCGTCCGCCGCTGCGTCTGGGCGAGTTCGCGATGCCAAAATATGAAATCATCTCCCTGC
CGGAAACGCACCTGGTCGGCACCACGCAGAGCTACTCCTGCTCCCTGGAGCAGATCTCCGAGTTCCGCCATCAGATGCGC
GTTCAGTTCTGGCGCGAATTTTTAAGCCACGCTCCGGCGATCCCGCCGATTCTGTATGGTTTGAACGAAACGCATCCAAG
CCAGGAAAAAGATGACGAGCAGGAGGTGTTCTATACCACGGCGCTGACGCCTGACATGGCGAACGGTTACATTCATGGCT
CGAAGCCTGTCGTGCTGGAAGGCGGCGAGTATGTGATGTTCTCATACGAAGGTTTAGGAACGGGCGTTCAGGAGTTCATC
CTGACCGTTTACGGGACCTGCATGCCGATGCTGAATCTGAATCGCCGTAAAGGTCAGGACATTGAGCGCTACTATCCGGC
GCAAGATGCTAAACCGGAAGAAGGCCCTATCAATCTGCGTATGGAATTCCTGATTCCGGTACGTCGTTAA