MEGAResFrom MEG, the Microbial Ecology Group

PVRR

The pvrR gene encodes a regulatory protein that has been implicated in the conversion from antibiotic-resistant to antibiotic-susceptible forms of Pseudomonas aeruginosa in studies of cystic fibrosis.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|AF482691.2|2796-3996|ARO:3003688|PvrR|Multi-drug_resistance|MDR_regulator|PVRR
ATGAGCTGGAAATCCTATCGGGTGCTGGTGGTCGAAGATCAGCCGTTTCAGCGCGAATACCTGCTCAACCTGTTTCGCGA
GCGCGGCGTGCAGTACCTGGTAGGTGCCGGCGACGGCGCGGAGGCGTTGCGCTGCCTGAAGCAGGACAGGTTCGACCTGA
TCCTCAGCGATCTGATGATGCCGGGCATGGATGGTATCCAAATGATCCTGCAACTGCCGTATCTCAAGCATCGTCCGAAG
CTGGCGCTGATGAGCTCCTCGTCGCAGCGGATGATGCTCAGTGCCAGCCGGGTCGCCCAGAGTCTCGGCTTGTCGGTAAT
CGACCTGTTGCCCAAGCCGACTCTGCCCAAGGCCATCGGCCAACTTCTGGAACACCTGGAAAGATGCCTCAGGCAGAAGC
TGGAGCCGGAAACCGACGAGACTCCGCATGGGCGCACGGCGTTGCTGGATGCCCTGCATAACGAGCAACTGGTGACCTGG
TTCCAGGCTAAGAAATCCCTCCACACCGGGCGCATAGTCGGCGCCGAGGCGTTGATACGCTGGAGCCACCCGCAGCATGG
CCTGTTGCTGCCCAGCTGTTTCATGAGTGATGTCGACGCTACCGGTCTGCACGAGGCGTTGCTCTGGCGCGTGCTCGAAC
AGACCCTGAACGCCCAGGAATCGTGGCGCAGGGCGGGTTACGAGATTCCGGTTTCGGTGAATCTGCCGCCGCACCTGCTC
GATAACCAGGAACTTCCGGATCGACTCTATGAGTACGTCGGCGCTCGCGGGGCTTGTACCAGCTCACTATGTTTCGAGTT
GACCGAGAGCAGTGTCACAACTCTGTCAAGTAACTACTATGCAGGTGCCTGTCGCTTGCGCATGAAAGGGTTCGGATTGG
CCCAGGACGACTTTGGCCAGGGTTACAGCTCGTTCTATAACCTGGTCACGACGCCTTTCACGGAGCTGAAGATCGACCGC
TCCCTAGTCCAGGGATGCGTAGAGGATAACGGCCTCAATGCAGCTGTCATCAGTTGTATTGAGTTGGGTCACCGCCTGAA
TCTCGACGTGGTGGCCGAAGGCGTGGAGACCTGCGAGGAACTGAATCTTCTTCGTCGTCTTGGCTGCGACCGGGCGCAGG
GTTTCCTGATTTCTAAGGCAGTGTCTGCTCGTGAGTTCGAGCGGCAGTTAAGGGAGGACGGCCCCAGCCTCCTTGTTTAA