MEGAResFrom MEG, the Microbial Ecology Group

NFXB

The nfxB gene encodes a LacI/GalR family regulator of the MexCD multi-drug efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>Mdr|NC_002516.2.881079|Multi-drug_resistance|MDR_regulator|NFXB
ATGACCCTGATTTCCCATGACGAGCGACTCATCAAGGCGCTGGCAGTCGCTATCGTCGACCGCCCGCGAGCGACGCTGAA
GGAACTGGCCGAGGCGGCCGGCGTAAGCAAGGCCACCCTGCACCGCTTCTGCGGCACGCGGGACAACCTGGTGCAGATGC
TCGAGGACCACGGAGAGACCGTACTGAACCAGATCATCCAGGCCTGCGACCTGGAGCATGCCGAGCCTCTGGAGGCGTTG
CAGCGCCTGATCAAGGAACACCTCACCCACCGCGAGCTGCTGGTATTCCTGGTATTCCAGTACCGCCCGGACTTCCTCGA
CCCGCACGGCGAAGGCGCACGCTGGCAGTCCTACCTGGAAGCGCTGGACGCCTTCTTCCTGCGCGGACAGCAGAAAGGCG
TGTTTCGCATCGACATCACGGCGGCCGTGTTCACCGAACTGTTCATCACCCTGGTCTACGGCATGGTCGATGCGGAACGT
CGCGGACGGGCGGCCAGCTCCAATTCCGCGCATACCCTGGAGCAGATGTTCCTCCATGGCGCCTCCAATCCGGCTCGCTC
CTGA