MEGAResFrom MEG, the Microbial Ecology Group

NALD

The nalD gene encodes a transcriptional regulator of the MexAB-OprM efflux system in Pseudomonas aeruginosa.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>Mdr|NC_002516.2.880183|Multi-drug_resistance|MDR_regulator|NALD
ATGCGACGCACAAAGGAAGATTCTGAAAAAACCCGTACGGCCATCCTCCTGGCCGCCGAGGAACTGTTCCTGGAAAAGGG
CGTGTCCCATACCAGCCTGGAACAGATCGCCAGGGCCGCCGGGGTGACCCGTGGCGCCGTCTACTGGCACTTCCAGAACA
AGGCCCACCTGTTCAACGAGATGCTCAACCAGGTACGCCTGCCGCCGGAGCAACTCACCGAGCGCCTGTCCGGCTGCGAT
GGCAGCGACCCGCTGCGCTCGCTCTACGACCTCTGCCTGGAGGCCGTGCAATCGTTGCTGACGCAGGAGAAGAAGCGCCG
CATCCTGACCATCCTGATGCAACGTTGCGAATTCACCGAGGAACTGCGCGAGGCGCAGGAACGCAACAACGCCTTCGTGC
AGATGTTCATCGAACTCTGCGAGCAGTTGTTCGCCCGCGACGAATGCCGTGTGCGGCTGCATCCGGGCATGACCCCGAGG
ATCGCCTCGCGCGCCTTGCACGCGCTGATCCTGGGCCTGTTCAACGACTGGTTGCGCGACCCGCGCCTGTTCGATCCGGA
TACGGACGCGGAACACCTGCTGGAGCCGATGTTCCGTGGCCTGGTGCGCGACTGGGGTCAGGCCAGCTCGGCGCCGTAG