MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MGRA

THe mgrA gene encode a repressor of the NorB and Tet38 efflux systems in Staphylococcus aureus.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/15774883

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in MDR regulator

Sequences

Download Sequences

>>MEG_3943|Drugs|Multi-drug_resistance|MDR_regulator|MGRA
ATGTCTGATCAACATAATTTAAAAGAACAGCTATGCTTTAGTTTGTACAATGCTCAAAGACAAGTTAATCGCTACTACTC
TAACAAAGTTTTTAAGAAGTACAATCTAACATACCCACAATTTCTTGTCTTAACAATTTTATGGGATGAATCTCCTGTAA
ACGTCAAGAAAGTCGTAACTGAATTAGCACTCGATACTGGTACAGTATCACCATTATTAAAACGAATGGAACAAGTAGAC
TTAATTAAGCGTGAACGTTCCGAAGTCGATCAACGTGAAGTATTTATTCACTTGACTGACAAAAGTGAAACTATTAGACC
AGAATTAAGTAATGCATCTGACAAAGTCGCTTCAGCTTCTTCTTTATCTCAAGATGAAGTTAAAGAACTTAATCGCTTAT
TAGGTAAAGTCATTCATGCATTTGATGAAACAAAGGAAAAATAA