MEGAResFrom MEG, the Microbial Ecology Group

MGRA

THe mgrA gene encode a repressor of the NorB and Tet38 efflux systems in Staphylococcus aureus.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_013450|694852-695296|ARO:3000815|mgrA|Multi-drug_resistance|MDR_regulator|MGRA
TTATTTTTCCTTTGTTTCATCAAATGCATGAATGACTTTACCTAATAAGCGATTAAGTTCTTTAACTTCATCTTGAGATA
AAGAAGAAGCTGAAGCGACTTTGTCAGATGCATTACTTAATTCTGGTCTAATAGTTTCACTTTTGTCAGTCAAGTGAATA
AATACTTCACGTTGATCGACTTCGGAACGTTCACGCTTAATTAAGTCTACTTGTTCCATTCGTTTTAATAATGGTGATAC
TGTACCAGTATCGAGTGCTAATTCAGTTACGACTTTCTTGACGTTTACAGGAGATTCATCCCATAAAATTGTTAAGACAA
GAAATTGTGGGTATGTTAGATTGTACTTCTTAAAAACTTTGTTAGAGTAGTAGCGATTAACTTGTCTTTGAGCATTGTAC
AAACTAAAGCATAGCTGTTCTTTTAAATTATGTTGATCAGACATT

>Mdr|NC_002745.1123448|Methicillin|Multi-drug_resistance|MDR_regulator|MGRA
ATGTCTGATCAACATAATTTAAAAGAACAGCTATGCTTTAGTTTGTACAATGCTCAAAGACAAGTTAATCGCTACTACTC
TAACAAAGTTTTTAAGAAGTACAATCTAACATACCCACAATTTCTTGTCTTAACAATTTTATGGGATGAATCTCCTGTAA
ACGTCAAGAAAGTCGTAACTGAATTAGCACTCGATACTGGTACAGTATCACCATTATTAAAACGAATGGAACAAGTAGAC
TTAATTAAGCGTGAACGTTCCGAAGTCGATCAACGTGAAGTATTTATTCACTTGACTGACAAAAGTGAAACTATTAGACC
AGAATTAAGTAATGCATCTGACAAAGTCGCTTCAGCTTCTTCTTTATCTCAAGATGAAGTTAAAGAACTTAATCGCTTAT
TAGGTAAAGTCATTCATGCATTTGATGAAACAAAGGAAAAATAA