MEGAResFrom MEG, the Microbial Ecology Group

MEXT

The mexT gene encodes a transcriptional regulator that affects expression of the MexEF efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>Mdr|NC_010400.5986505|Multi-drug_resistance|MDR_regulator|MEXT
ATGAATCTGGAGCGGGTAGATCTTAATCTATTAATATATCTTGATGTTCTTCTTCGTGAAAAAAACGTTACTCGCGCAGC
CGAACAGCTTGGTGTTACTCAGCCTGCCATGAGTAATATTTTACGCCGCTTGCGTAATTTATTTAATGACCCTCTCCTGA
TCCGCTCATCTGAAGGGATGACACCGACAGAACGTGCACTTGAATTACAACCGCGTATTCGTGATGCTCTTTCTGACCTT
TCAATGATTTTGGAACCGCGTACCGAATTCCGCCCTTATACCAGTAATCGCGTTTTCCGTATTATGACTTCTGACTATGC
AGAAGCCACCCTAGTCCCTCGTCTTGTTAAAGCCCTCCGCTCAGAAGCACCAAACGTTGTACTCGATTTTCTTACTCCAA
GTGATGTGTCATATAGAGACATGGAACAGGGTAAAGTTGATCTAGCCATTAACCGCTTCAATGAAATCCCGCAAAGCTTC
CACCAAGTTTTGGTTTGGCGTGATAGCTTTAGCTGTATTTTAAATGACAAACACCCCGCTGTGACTCATTTAAATCTAAA
AAGCTATTTAGATGCTCAACATATTTGGGTATCTAAAACGGGTATGGGTGTTGGCTTTGGGGTAAACCCAGATAAACAAG
GTGGCTTGGGCTGGATTGATCAAGCATTAGAACGTATTGGTCAACGTCGCAAAATTTCTGTATTTACACGTCACTATCAG
ATGCCGGCATTACTTGCTCAAAATGTTGACTTGATTGCCACTCTTCCAACTCGAATGGCACGTTTACAAGCACAAAATCC
AAAATTAGTCATTAAAGATCCACCGTTTTACATTCCTGAGTTCGAACTTAAAATGGCTTGGTGTCCATTATTGCACCATC
ACCCAGCTCATCGCTGGTTACGCCAACTCATTCTATTTGTTGCTCGCCAAATGATCGAAGAGGAAAATCGTGAATTCCTA
ACCAATAATTCACAATTTTCCCACTATTAA

>Mdr|NC_010611.6236744|Multi-drug_resistance|MDR_regulator|MEXT
ATGAATCTGGAGCGGGTAGATCTTAATCTATTAATATATCTTGATGTTCTTCTTCGTGAAAAAAACGTTACTCGCGCAGC
CGAACAGCTTGGTGTTACTCAGCCTGCCATGAGTAATATTTTACGCCGCTTGCGTAATTTATTTAATGACCCTCTCCTGA
TCCGCTCATCTGAAGGGATGACACCGACAGAACGTGCACTTGAATTACAACCGCGTATTCGTGATGCTCTTTCCGACCTT
TCAATGATTTTGGAACCGCGTACCGAATTCCGCCCTTATACCAGTAATCGCGTTTTCCGTATTATGACTTCTGACTATGC
AGAAGCCACCCTAGTCCCTCGTCTTGTTAAAGCCCTCCGCTCAGAAGCACCAAACGTTGTACTCGATTTTCTTACTCCAA
GTGATGTGTCATATAGAGACATGGAACAAGGTAAAGTTGATCTAGCCATTAACCGCTTCAATGAAATCCCGCAAAGCTTC
CATCAAGTTTTGGTTTGGCGTGATAGCTTTAGCTGTATTTTAAATGACAAACACCCTGCTGTGACTCATTTAAATCTAAA
AAGCTATTTAGATGCTCAACATATTTGGGTATCTAAAACGGGTATGGGTGTTGGCTTTGGGGTAAACCCAGATAAACAAG
GTGGCTTGGGCTGGATTGATCAAGCATTAGAACGTATTGGTCAACGCCGCAAAATTTCTGTATTTACGCGTCACTATCAG
ATGCCGGCATTACTTGCTCAAAATGTTGACTTGATCGCTACTCTTCCAACTCGAATGGCACGTTTACAAGCACAAAATCC
AAAATTAGTTATTAAAGATCCACCGTTTTACATTCCTGAGTTTGAACTTAAAATGGCTTGGTGTCCATTATTGCACCATC
ACCCAGCTCATCGCTGGTTACGCCAACTCATTCTATTTGTTGCTCGCCAAATGATCGAAGAGGAAAATCGTGAATTCCTG
ACTAATAATTCACAATTTTCCCACTATTAA