MEGAResFrom MEG, the Microbial Ecology Group

MEXL

The mexL gene is a repressor of the MexJK multi-drug efflux system in Pseudomonas aeruginosa.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|AE004091.2|4120468-4121107|ARO:3003710|mexL|Multi-drug_resistance|MDR_regulator|MEXL
ATGTCAGAATCCACCTCCTCCGTCGGTCCCGGCCGGCCCAAGGACCCGGCCAAACGGGAAGCCATTCTCGAGGCGGCCAA
GCGCCTGTTCCTCTGCAACGGCTACGACGGCAGCAGCATGGAAGCCATCGCCTCGGAAGCCGGCGTTTCCAAGCTCACCG
TCTACAGCCACTTCACCGACAAGGAAACCCTGTTCAGCGAAGCGGTGAAGGCCAAGTGCGCCGAGCAGCTTCCCGCCCTG
TACTTCCAGCTGGCCGAAGGCGCGCCACTGGAAAAGGTCCTGCTGAATATCGCCCGCGGCTTCCACCGGCTGATCAACAG
CCACGAGGCGATCGCCCTGACCCGCCTGATGGCCGCGCAGGCCGGGCAGAACCCCAAGCTTTCCGAGCTGTTCTTCGAGG
CCGGGCCGAAGCAGGTGATCGACGAGATGGAACGCCTCCTCGAGCAGGCCCGCCGCAGCGGCAAGCTGGCGTTCCCGGAC
GCGCGCCACGCCGCCGAACACTTCTTCATGCTGGTCAAGGGCTGCGCCAATTACCGTCTGTTGATCGGCTGCGCCGAACC
GCTGGACGAGGCCGAAGGCGAGCGGCACGTGGAAGAAGTGGTGGCGCTGTTCCTGCGCGCCTTCGCCGCGGGCGGCTGA