MEGAResFrom MEG, the Microbial Ecology Group

MEPR

The mepR gene encodes a transcriptional regulator that affects the expression of the MepA efflux pump.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>Mdr|NC_002745.1123101|Multi-drug_resistance|MDR_regulator|MEPR
ATGGAATTCACTTATTCGTATTTATTTAGAATGATTAGTCATGAGATGAAACAAAAGGCTGATCAAAAGTTAGAGCAATT
TGATATTACAAATGAGCAAGGTCATACGTTAGGTTATCTTTATGCACATCAACAAGATGGACTGACACAAAATGATATTG
CTAAAGCATTACAACGAACAGGTCCAACTGTCAGTAATTTATTAAGGAACCTTGAACGTAAAAAGCTGATCTATCGCTAT
GTCGATGCACAAGATACGAGAAGAAAGAATATAGGACTGACTACCTCTGGGATTAAACTTGTAGAAGCATTCACTTCGAT
ATTTGATGAAATGGAGCAAACACTCGTATCGCAGTTATCTGAAGAAGAAAATGAACAAATGAAAGCAAACTTAACTAAAA
TGTTATCTAGTTTACAATAA